Question: answer please Every morning before your first class, you line up at Tim Horton's on the BCIT campus. You notice that it takes between 15

answer please

Every morning before your first class, you line up at Tim Horton's on the BCIT campus. You notice that it takes between 15 to 29 minutes to get through the lineup, give your order to the cashier, and receive your coffee, donut, and wrap. The time to get your order follows a uniform distribution. (a) What is the probability that it will take at least 20 minutes to get your order? (enter a number between 0 and 1 in 4 decimal places) 0.6428 (b) You arrive at Tim Horton's at 8:00 am. What is the probability that you receive your order before your friends show up at 8:25 am at Tim's? (enter a number between 0 and 1 in 4 decimal places) 0.7142 (c) 20% of the time it takes you longer than how many minutes to get your order? (answer in 2 decimal places) min

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Mathematics Questions!

Describing Data Once we have collected data from surveys or experiments, we need to summarize and present the data in a way that will be meaningful to the reader. We will begin with graphical...

1-Please provide 5 cross-examination questions for: Chris Moss Dr. Gerry Stein Sydney Payne Terry Preece Leslie Brown Alex Lloyd 2-Explain why/how/if you would use exhibits A, B, C, and D. 3-What...

4) Parktown Realty Inc developed an upscale condominium complex. On October 1, Miranda Wine signed an offer to purchase one of the units. Part of that document said, "This offer is irrevocable by the...

Case study: Remedy Physiotherapy. I need help in drafting a marketing plan Names of people and businesses are disguised. Some aspects of the local area and the physiotherapy industry are simplified...

23 Nickel and Dimed: On (Not) Getting By in America BARBARA EHRENREICH Major changes in welfare legislation in 1996 eliminated cash payments to millions of America's poor, requiring them to find...

CASE EXAMPLE Google: who drives the strategy? Phyl Johnson, Strategy Explorers From an idea to a verb in less than 15 years: 'to Google - to search the Internet' If you are in need of the answer to a...

Please read the question Question: Choose one of the teaching strategies from the article that you read 1. What is the teacher is trying to accomplish by using this technique? (That is, what's the...

Please read the question Question: Choose another different one of the teaching strategies from the article that you read 1. What is the teacher is trying to accomplish by using this technique? (That...

Supply Chain Management Introduction Outline What is supply chain management? Significance of supply chain management. Push vs. Pull processes utdallas.edu/~metin 1 A Generic Supply Chain Sources:...

Decision Support Tools Main Content Quiz Test 2 (S1) Question 1 Answer saved Marked out of 1.00 Question text If we know that the length of time it takes a college student to find a parking spot in...

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA

Carmel Harrison runs Emerald Spa, a business providing women-only hairdressing, beauty, relaxation massage, and counseling services in a small tourist town. Ninety percent of the clients using the...

Which one of the following values would be the most preferable as a Sharpe ratio? Question 1 9 options: A ) 1 . 1 1 B ) . 8 9 C ) 0 D ) 1 . 1

I NEED 450+ WORDS TOTAL. WRITE IN YOUR OWN WORD. NO PLAGIARISM PLEASE. 1. What is The Project Life Cycle (Phases) 2. Are there any disadvantages to following a life-cycle approach to project...

5. List three of what you would call your core values. For each of these core values, answer the following questions. a. What is the purpose of this value in your life? b. How does this value affect...

3. What values would you say are your core values?

12. Think of a situation where you felt particularly powerless. It must be a real event that you remember relatively well. Try to think back. What was it you imagined just before you felt powerless...