Question: Lunga (Pty) Ltd, a retailer has the following working capital accounts. Year 2020 2019 2018 Current Assets Cash 2000 1500 1000 Accounts receivables 6000

Lunga (Pty) Ltd, a retailer has the following working capital accounts. Year

Lunga (Pty) Ltd, a retailer has the following working capital accounts. Year 2020 2019 2018 Current Assets Cash 2000 1500 1000 Accounts receivables 6000 4000 2000 Inventory 8000 4500 2000 Total current assets 16000 10000 5000 Current Liabilities Accounts payables 4500 3500 2000 Short-term liabilities 3500 1500 500 Total current liabilities 8000 5000 2500 Marks (1) Calculate and comment on Lunga's liquidity position for the financial years 2018 2020, based on: i) Current ratio 10 ii) Quick ratio i) Cash ratio Describe and calculate other useful indicators that can be used to understand (2) further the liquidity position of Lunga (Pty) Ltd. Comment on your results 11 Using the results of parts (1) and (2) above, discuss the limitations of the (3) 4 current ratio as a measure of liquidity. List and describe other ratios, apart from liquidity ratios, that would be useful (4) for the analysis of Lunga's liquidity situation in (1) and (2) above. Clearly state 7 what you would expect these ratios to show.

Step by Step Solution

★★★★★

3.41 Rating (167 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

Part 1 i Current Ratio Current AssetsCurrent Liabilities The Current ratio remained same for all the years It is maintained at 2 This is a good current ratio where current assets are almost double the ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!

The owner of Neros company has hired you to analyze her company's performance and financial position, as well as the positions of Iits competitors, Centar and Xermix. However, the data Neros abtained...

List two substantive analytical procedures that can be used to provide audit evidence related to the payroll expense accounts and the payroll- related liabilities.

Comment on the key guidelines that can be used to identify whether a change in the accounts shown on a statement of financial position between two consecutive accounting periods is a cash inflow or a...

List and describe the strategies that can be used to overcome resistance to change.

For Gee-Whiz Devices calculate the following: working capital, current ratio, and acid-test ratio.Gee-Whiz Devices Balance Sheet Data Cash $100,000 Market securities 45,000 Net accounts and notes...

In the right-hand column below, certain financial ratios are listed. To the left of each ratio is a business transaction or event relating to the operating activities of Delta Company (each...

A parallel RLC circuit, which is driven by a variable frequency 2-a current source, has the following values: R=1Kohm,L=100mH, and C=10F. Find the bandwidth of the network, the half-power...

Market Values and Book Values Klingon Widgets, Inc., purchased new cloaking machinery three years ago for $7 million. The machinery can be sold to the Romulans today for $3.7 million. Klingons...

Calculating Cash Flows Consider the following abbreviated financial statements for Parrot head Enterprises: a. What is owners?? equity for 2006 and 2007? b. What is the change in net working capital...

For Gray Corporation, the working capital at the end of the current year is $10,000 more than the working capital at the end of the preceding year, reported as follows: Has the current position...

Inferring Bad Debt Expense and Determining the Impact of Uncollectible Accounts on Income and Working Capital A recent annual report for Target contained the following information (dollars in...

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Give me the list of labor hourly out puts for construction?

Philosophy underlying elimination of intercompany transactions When preparing conselidgted financial satements, what is the main remon we eliminat all intercompany transactions between and among a...

In Corporation uses the weighted-average method in its process costing system. Data concerning the first processing department for the most recent month are listed below Beginning work in process...

Tandy purchased a washing machine from Marshall Appliances. The sales contract included a provision explicitly disclaiming all express and implied warranties, including the implied warranty of...

What rate of discount has been allowed if an item that lists for $270 is sold for $168.75? please use TI BAII calculator no formulas

Q.2 Obtain the Thevenin equivalent at terminals a-b of the circuit in Fig. 1A 10 2 16 2 102 52 8V

Q.1 Apply Thevenin's theorem to find Vo in the circuit of Fig. 12 5Q 3A 16 Q 10 12 V

The fastest earthquake wave is the Group of answer choices ultrasonic wave ground wave P wave de Broglie wave S wave

QUESTION 1 40 MARKS a) The objective of financial statements is to enable users make economic decisions based on the information contained in the income statement, balance sheet and cash flow...

b) Lunga (Pty) Ltd, a retailer has the following working capital accounts. Year 2020 2019 2018 Current Assets Cash 2000 1500 1000 Accounts receivables 6000 4000 2000 Inventory 8000 4500 2000 Total...

any of the users below were to make decisions on how financial statements should be prepared, what do you think would be their focus, and what principle/s do you think would underpin the financial...

Need answer to Q1&2 Urgently 25 MARKS QUESTION 1 a) The objective of financial statements is to enable users make economic decisions based on the information contained in the income statement,...

b) Lunga (Pty) Lid, a retailer has the following working capital accounts. Year 2020 2019 2018 Current Assets Cash 2000 1500 1000 Accounts receivables 6000 4000 2000 Inventory 8000 4500 2000 Total...

2018 - 2020, based on: 10 i) Current ratio ii) Quick ratio iii) Cash ratio Describe and calculate other useful indicators that can be used to understand (2) 11 further the liquidity position of Lunga...