Below is a section of single$-$stranded DNA that was just isolated from a population of unicellular creatures just found on Mars. We will call this the normal allele or wild$-$type allele.

$$

$5$TTGCCCAAATGTATACCATCATGGAATTTCTTATAGAGTCATTCGCATCGACATTACACAGGTAGAGCTGCAGGCCATTACCATGTAAGAT$3$

$$

$1.$ If this piece of DNA were to be a template during DNA replication, what would the resulting double$-$stranded DNA look like?$$ Assume that everything works on Mars just like on Earth unless you are told differently.$$ Replicate it properly and show all important components of both DNA strands. Type it out so you do not make a mistake and I can read it$.$