Question: c + + Write a program that takes a string representing the DNA for one or more proteins, breaks it up into the proteins, and
c Write a program that takes a string representing the DNA for one or more proteins, breaks it up into the proteins, and prints them out. You will be starting with something like: CATCCACCAGAAGGCTAATCTCCTTAA If the string does not end with a "stop" sequence, print out an error message and stop. For full credit, you should detect any of the three stop sequences TAA TAG, or TGA but you may focus on only TAA at only a small deduction of points. Otherwise, identify each protein in the string by looking for stop sequences.
Step by Step Solution
There are 3 Steps involved in it
1 Expert Approved Answer
Step: 1 Unlock
Question Has Been Solved by an Expert!
Get step-by-step solutions from verified subject matter experts
Step: 2 Unlock
Step: 3 Unlock
