Write a program that takes a string representing the DNA for one or more proteins, breaks it up into the proteins, and prints them out. You will be starting with something like: CATCCACCAGAAGGCTAATCTCCTTAA If the string does not end with a "stop" sequence, print out an error message and stop. For full credit, you should detect any of the three stop sequences $($TAA$,$ TAG, or TGA$),$ but you may focus on only TAA at only a small deduction of points. Otherwise, identify each protein in the string by looking for stop sequences.