Question: Choose the correct 2 primers needed to amplify only the highlighted sequence of DNA using PCR: 5 ' - TCAGTACCAAAATCGAGCTGACAAATTGCAGACACGGTCGAGTGCGCAT - 3 ' A 5

Choose the correct 2 primers needed to amplify only the highlighted sequence of DNA using PCR:
5'- TCAGTACCAAAATCGAGCTGACAAATTGCAGACACGGTCGAGTGCGCAT -3'
A 5' CCAAA 3' and 5' CGAGT 3*
B)5' CCAAA 3' and 5' ACTCG 3'
C 5' CAGTA 3' and 5' TGCGC 3'
D
3' CCAAA 5' and 3' ACTC 5'
5' GGTTT 3' and 5' TGAGC 3'

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!