CODE IN PYTHON dna2codon=

def rna2codon(seq): table = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L", "UCU":"S", "UCC":"s", "UCA":"S", "UCG":"S", "UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP", "UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W", "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L", "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P", "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q", "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R", "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M", "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T", "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K", "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R", "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V", "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A", "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E", "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",} protein ="" if len(seq)%3 == 0: for i in range(0, len(seq), 3): codon = seq[i:i + 3] if table[codon]!="STOP": protein+= table[codon] return protein print( rna2codon("AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA")) def locate_substring(dna_snippet,dna): indexes = [i for i in range(len(dna_snippet)) if dna_snippet.startswith(dna, i)] return indexes print(locate_substring("GATATATGCATATACTT","ATAT"))

def count_dom_phenotype(genotypes): This function takes in a list of six nonnegative integers corresponding to the number of couples in a population possessing a specific genotype pairing, such as AA-AA (both homozygous dominant) or Aa-aa (heterozygous and homozygous recessive). The list of integers represent the number of couples having the following genotypes, in this order: 1. AA-AA 2. AA-Aa 3. AA-aa 4. Aa-Aa 5. Aa-aa 6. aa-aa The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example: The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example: Sample input list: (1, 0, 0, 1, 0, 1) The returned number of dominant phenotype offspring: 3.5 def source_rna(protein): This function takes in a string representing a sequence of proteins and returns the total number of different source RNA strings, modulo 1,000,000. Essentially, you are calculating how many strands of mRNA from which this particular protein could have been translated. (HINT: You'll want to use/manipulate the codon table from rna2codon()9 Example: Sample input protein string: "MA" The returned number of possible source RNA sequences: 12 def count_dom_phenotype(genotypes): This function takes in a list of six nonnegative integers corresponding to the number of couples in a population possessing a specific genotype pairing, such as AA-AA (both homozygous dominant) or Aa-aa (heterozygous and homozygous recessive). The list of integers represent the number of couples having the following genotypes, in this order: 1. AA-AA 2. AA-Aa 3. AA-aa 4. Aa-Aa 5. Aa-aa 6. aa-aa The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example: The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example: Sample input list: (1, 0, 0, 1, 0, 1) The returned number of dominant phenotype offspring: 3.5 def source_rna(protein): This function takes in a string representing a sequence of proteins and returns the total number of different source RNA strings, modulo 1,000,000. Essentially, you are calculating how many strands of mRNA from which this particular protein could have been translated. (HINT: You'll want to use/manipulate the codon table from rna2codon()9 Example: Sample input protein string: "MA" The returned number of possible source RNA sequences: 12