I'm confused on the first function only...the code I have is typed below it in case I need to recall those functions. Thank you so much!

CODE IN PYTHON dna2codon=

def rna2codon(seq): table = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L", "UCU":"S", "UCC":"s", "UCA":"S", "UCG":"S", "UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP", "UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W", "CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L", "CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P", "CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q", "CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R", "AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M", "ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T", "AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K", "AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R", "GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V", "GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A", "GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E", "GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",} protein ="" if len(seq)%3 == 0: for i in range(0, len(seq), 3): codon = seq[i:i + 3] if table[codon]!="STOP": protein+= table[codon] return protein print( rna2codon("AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA")) def locate_substring(dna_snippet,dna): indexes = [i for i in range(len(dna_snippet)) if dna_snippet.startswith(dna, i)] return indexes print(locate_substring("GATATATGCATATACTT","ATAT"))

def count_dom_phenotype(genotypes): This function takes in a list of six nonnegative integers corresponding to the number of couples in a population possessing a specific genotype pairing, such as AA-AA (both homozygous dominant) or Aa-aa (heterozygous and homozygous recessive). The list of integers represent the number of couples having the following genotypes, in this order: 1. AA-AA 2. AA-Aa 3. AA-aa 4. Aa-Aa 5. Aa-aa 6. aa-aa The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example: def count_dom_phenotype(genotypes): This function takes in a list of six nonnegative integers corresponding to the number of couples in a population possessing a specific genotype pairing, such as AA-AA (both homozygous dominant) or Aa-aa (heterozygous and homozygous recessive). The list of integers represent the number of couples having the following genotypes, in this order: 1. AA-AA 2. AA-Aa 3. AA-aa 4. Aa-Aa 5. Aa-aa 6. aa-aa The function should return the expected number of offspring displaying the dominant phenotype in the next generation, assuming that every couple has exactly two offspring Example