Question: Determine possible amino acid sequences for the mRNA sequence shown below. Determine possible amino acid sequences for the mRNA sequence shown below. 5'-CCACGGAGGCCACAUA-3 Select all

Determine possible amino acid sequences for the mRNA sequence shown below.

Determine possible amino acid sequences for the mRNA sequence shown below. 5'-CCACGGAGGCCACAUA-3

Determine possible amino acid sequences for the mRNA sequence shown below. 5'-CCACGGAGGCCACAUA-3 Select all possible amino acid sequences. There will be more than one answer. This table of the genetic code may help. Ile-His-Arg-Arg-His His-Gly-Gly-His-lle Thr-Glu-Ala-Thr Pro-Arg-Arg-Pro-His Pro-Arg-Arg-Pro-lle One of your answers is incorrect. One of the sequences you chose has an error in which the reading frame shifted. Check the identity of the last amino acid.

Step by Step Solution

★★★★★

3.37 Rating (153 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

234 are Correct Sequences 1 and 5 are Incorrect Sequences Given mRNA sequence 5 CCA CGG AGG CCA CAU ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!

The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU,UUC Asp: GAU, GAC These sequences are complementary to the sequences...

The amino acid sequences of peptide fragments obtained from a normal protein and from the same protein synthesized by a defective gene were compared. They were found to differ in only one peptide...

Determine the amino acid sequence of a polypeptide from the following results: a. Complete hydrolysis of the peptide yields the following amino acids: Ala, Arg, Gly, 2 Lys, Met, Phe, Pro, 2 Ser, Tyr,...

For the plane truss shown in Figure P15 -3, bar element 2 is subjected to a uniform temperature rise of T = 60 °F. Let E = 30 Ã 106 psi, A = 2 in2, and a = 7.0 Ã 10-6 (in./in.)/...

Find the Y parameters for the two-port network shown infigure. 12 0 3 w- ww

A plastic siphon hose with D = 1.2 cm and L = 5.5 m is used to drain water (15C) out a tank. Calculate the velocity in the tube for the two situations given below. Use H = 3 m and h = 1 m. a. Assume...

For the periodic processes given below, find a valid schedule a. using standard RMS; b. adding one unit of overhead for each context switch. 22 P2 P1 P3 Process P1 P2 P3 Time Deadline 2 30 57 40 120...

For the unity feedback shown in Fig. P 3. 5, where \[G(s)=\frac{K}{s(s+3)(s+4)(s+5)}\] Obtain the following: (a) display a root locus and pause (b) draw a close-up of the root locus where the axes go...

Dr. Kirkland R. Gable studied 20 male juvenile delinquents who had each spent 6 months or more in a Massachusetts juvenile detention center. He wondered whether simply asking the juvenile delinquents...

The St. Lucia Blood Bank, a private charity partly supported by government grants, is located on the Caribbean island of St. Lucia. The blood bank has just finished its operations for September,...

Alaska Airlines showed the following items in its balance sheet as of December 31, 2011, the end of the fiscal year ($ in millions): Inventories and supplies .............. $ 44.3 Prepaid expenses...

You have $25 to purchase apps on your cell phone. Each app that you want costs $3.99. Describe the numbers of apps you can purchase.

A company that sells software as a service ( SaaS ) is providing: Option A A tangible good Option B A pure service Option C A hybrid product - service Option D A durable product

Identify an organization that was involved in corporate fraud. Explain how fraud can be detected and evaluate the importance of teamwork and leadership in a fraud investigation. Research the Internet...

Design the SOFTWARE MASTER REPORT containing pertinent information that helps Cher and Hy to locate the various copies of any software package easily. The elements necessary to produce the report are...

Radio Station CJXT is considering replacing its old, fully depreciated sound mixer. Two new models are available. Mixer X has a cost of $500,000, a five-year expected life, and after-tax cash flow...

The City of Pfeiffer starts the year of 2017 with the general fund and an enterprise fund. The general fund has two activities: education and parks/recreation. For convenience, assume that the...

AK Steel Holding Corporation is a fully integrated producer of steel. It produces cold-rolled and hot-rolled steel products as well as specialty stainless and electrical steels that are sold to the...

An experiment with a = 0.05 is more powerful than one where a = 0.01, other factors held constant. True or false

4:44 Lab 2 o Post Lab Questions: Name ID# 1. Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA) into the 6 possible amino acid sequences (that...

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

BME 201 HOMEWORK 5 - How to fix the code for DNA Replication, Transcription, and translation. InsulinDNAseq is included. Please help! 0 10f7 BME 201 Homework 5 - Molecular Biology: Transcription and...

Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating each gene...

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...