Question: Dynamic programming algorithm related to the DNA sequence matching. Attached is the image of the input data, read each record from the file and find

Dynamic programming algorithm related to the DNA sequence matching. Attached is the image of the input data, read each record from the file and find the line and column no's with the given DNA sequence key pattern. Please display locations(line and column) found in the input file as shown in the below sample output.

DNA sequence key pattern is "GGTAACGGCCCACCAAGGCGACGACGGGTAGCTGGTCTGAGAGGATGGCCAGCCACATTGGGACTG"

Output:

Key Pattern looking for:"GGTAACGGCCCACCAAGGCGACGACGGGTAGCTGGTCTGAGAGGATGGCCAGCCACATTGGGACTG"

key was found (Line, column):3422,123# read countand Nth column where pattern started

key was found (Line, column):12832 ,004

Total Number of read:records# Total number of read # Code and pattern are treated as one record.

Total execution time:hh/mm/sec

Dynamic programming algorithm related to the DNA sequence matching. Attached is the

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Programming Questions!

) Explain the term overloading in the context of Java constructors and methods. [2 marks] (b) Without describing the details of either, outline the relationship between the Java methods...

In this question assume that p and q are atomic formulae. (a) Compare and contrast path formulae and state formulae in temporal logic. [4 marks] (b) Describe and contrast the meanings of F(G p) and...

350 Specification and Verification II Explain how a register can be modelled either as a unit-delay, or with an explicit clock input. [4 marks] Describe the relationship between the two models. [4...

Question: Check you are in charge of the design of both hardware and software for a new (but fairly conventional) workstation which will have its peripherals (for example a disc drive and a printer)...

io (a) Give the general formula for estimating transition probabilities from training data. Provide the full transition matrix A for this HMM based on the training data shown. [6 marks] (b) Give the...

Jot java program to find if a particular element is present in a multi-dimensional array. Here is the related facts that might help to solve the problem - *************** Consider the function zarg...

I have to create a program in C and I can't figure it out. The program has to read a source file. Please help. /******************************************************************** PROJECT: Glossary...

Let A, B be sets. Define: (a) the Cartesian product (A B) (b) the set of relations R between A and B (c) the identity relation A on the set A [3 marks] Suppose S, T are relations between A and B, and...

Lesson 12 Quiz (Show/Explain all Work) IST 230 Relations on Sets, Databases 1. Let A = {0, 1, 2, 3, 4, 5, 6, 7, 8} and B = {1, 2, 3, 4, 5, 6, 7, 8}. Now let R be a binary relation R from A to B such...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

Based on the table, evaluate the impact of economic and financial risks for a new employee who wishes to enroll in one of the above programs. How does a company report them on the financial...

Operations for Janelle Company for 2011 and 2012 are summarized below. Required: 1. Prepare common-size income statements for 2012 and 2011. 2. What caused Janelle's profitability to decline so...

The requirements for accounting for and reporting of investor under IFR S compared to GAAP tend to be more a full of disclosure requirements B roles based C detailed D principles based

A company issues 1,050 shares of its common stock for $33,600 cash. Prepare journal entries to record this event under each of the following separate situations.