Question: Expect the codons for amino acids involved only two bases instead of three. Would there be a sufficient number of codons for all of the

Expect the codons for amino acids involved only two bases instead of three. Would there be a sufficient number of codons for all of the 20 amino acids? Show how you find your solution.

Step by Step Solution

★★★★★

3.47 Rating (157 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

Solution Three is the minimum number of nucleotides per codon needed to encode 20 ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (2 attachments)

6360b77208b01_234800.pdf

180 KBs PDF File

6360b77208b01_234800.docx

120 KBs Word File

Students Have Also Explored These Related Programming Questions!

Watch the video on valuing bonds. It shows how to calculate a bonds value with an example of a $1,000 bond making $100 annual payments, when the interest rate is 8%. Would there be a point (length to...

Would there be a violation of the Paycheck Fairness Act if this legislation has amended the FLSA?

If the ownership is 100% would there be a difference between upstream and downstream sales?

You have been hired by a genome lab to write a java program that will read in information from a text file and produce specific results to the screen and an output file. Concepts Arrays of objects...

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...

You have a cDNA, part of the sequence of which is reproduced in Figure 3. You want to insert the portion encoding the highlighted region (WW3) into an expression vector, pAcGFP1 (Fig. 4) to produce a...

Read the article: Bolton, P., Brunnermeier, M. K., & Veldkamp, L. (2013). Leadership, Coordination, and Corporate Culture. Review Of Economic Studies, 80(2), 512-537. Based on the article findings,...

1)Discuss roles of NGOs and social innovation in the Lebanese context. Why NGOs are considered to be Ethical Entities? 2) Discuss the social innovation and how it is related to the recycling...

17.4. Reconsider the Dewright Co. case study as presented in Sections 17.1 and 17.2. After further reflection about the optimal solution obtained by using weighted goal programming, management now is...

Read Chapter 6 of the book "How to measure anything". Now, write a letter to Mr. Williams, starting with the following statement: "Mr. Williams, currently you work with categorical risk metrics...

Assume that your business is working on a complicated project that is supposed to be completed in 12 months. Every month you are supposed to complete a work, worth $20000. After the fourth month the...

If a yield curve looks like the one below, what is the market predicting about the movement of future short-term interest rates? What might the yield curve indicate about the markets predictions...

Richard Eco setting up a system to managers certificates of insurance company receives from some subcontractors what are the key steps Richard certificate management system should include

Below is a beautiful satellite image of a hurricane/cyclone/typhoon approaching a coastline. On which side of the storm would the coastline experience the largest storm surge? (You can assume that...

Write the following as multivariable functions in MATLAB a. f(x, y) = x2 + y? b. g(x, y) = 2xy c. h(x, y,z) = xy + z? d. Compute the following i. f(3,4) ii. VF(3,4) iii. g(5,3)

Given an objective function value of 150 and a shadow price for resource 1 of 15, if 2 more units of resource 1 are added (assuming the allowable increase is greater than 10), what is the impact on...

Describe the type of reaction with which this morphine derivative is obtained and identify the reagents necessary to carry it out. . How Morphine

b) If there’s a chance of existing monopoles, then Maxwell’s equation requires two more terms: Magnetic charges (ρ*) and Magnetic current density (J*). Now write Maxwell’s 4...

Predict the organic product(s) of the reaction of 2-butene with each reagent. (a) H2O (H2SO4) (b) Br2 (c) Cl2 (d) Br2 in H2O (e) HI (f) Cl2 in H2O (g) Hg(OAc)2, H2O (h) product (g) 1 NaBH

Part A Nucleotides have three parts: a phosphate group, a sugar, and a base. Label those parts in the nucleotide shown here. Drag each label to the appropriate target. View Available Hint(s) Reset...

in python please ! a string consisting purely of nucleotides by first removing the in and then all the newline characters. You'll need to do the following to find all the occurrences of the...

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Write the data processing methods, such as codon() and codon2aa() in a separate Java class, and the input and output in another class. (include comments) 1. Develop a Java program to read in a piece...

CSC 143 You are required to complete this exercise using Java Map Collections Framework (as described in Chapter 11). Attach the source code file (*.java) when submitting this. Hint: here is the...