Question: Find the alignment of these sequences manually using the MUMer algorithm on these MUMs (each color sequence is a MUM) TAGCATAGGGATAGTGAACACACA ATAGCCTAGTATAGGTTAACACATC a. Number the

Find the alignment of these sequences manually using the MUMer algorithm

Find the alignment of these sequences manually using the MUMer algorithm on these MUMs (each color sequence is a MUM) TAGCATAGGGATAGTGAACACACA ATAGCCTAGTATAGGTTAACACATC a. Number the mums and show the LIS that you selected. b. Show the global alignment of the two sequences (you can do in between-MUM parts manually -- doesn't have to be optimal)

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

ABC Company makes steel tool cabinets for offices. They are in the process of preparing a Master Budget including the Operating budget, Cash Statement, Income Statement and Balance Sheet for 2020....

hi I need answers to those questions as soon as possible thank you File Home Insert Draw Page Layout Formulas Data Review View Help Share Comments @ A & Cut Garamond 12 III NO ab Wrap Text General...

For this assignment you will use the correct solution to Assignment 1 as a starting point. There you should have completed MRP tables for weeks 12-19 for the 32" RH, 32"LH, 36" RH, and 36" LH...

Alignment Number M88 B D G M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 7 8 9 0 Details of McCormick Plant Proposal As you know from Project 4, McCormick & Company is considering building a new factory...

Please help me the formula for the deduction part (OASDI,Medicare, FWT, SWT,..) and entry payroll tax expense - 2 X - x Insert Delete Format X 2 -3 = Bronson Co. Payroll Register PART 1(2) (1).xlsx -...

Recursion is a powerful technique that is widely used in addressing real world problems. Many real world problems can be solved using recursive algorithms that cut down computation significantly. The...

Drawing from the article below, complete the following. What should you, as the CEO, do to navigate this process? What do you expect from the team as you transition into your new role? How New CEOs...

Algorithms Question, thanks Recall the Edit Distance (Sequence Alignment) problem: given two strings over the same alphabet and mismatch and gap penalties, find an alignment of minimal cost. One of...

Standard Product Cost, Direct Materials Varlance Condiments Company uses standards to control its materials costs. Assume that a batch of ketchup (2,400 pounds) has the following standards: Standard...

From the following equation of the parabola: y? =-8x, graph and calculate: a) Vertex and focus b) Position C) Form of the equation d) Equation of the directrix

Which of these calculation cards is the odd one out? Explain why. A 6.30.9 B 1.40.2 C 4.9 0.7 D 4.80.6 E 5.60.8

Which of the following are problems with identifying users of ABC? Multiple select question. ABC means different things to different organizations. Organizations will announce the discontinuance of...

7. Do you use occasional gestures to emphasize a point youre making in your speech? Do they feel natural?

B You may have been reading this scenario under the assumption that you do not have any physical challenges. Now imagine that you have speech challenges or that you suffer from a chronic illness....

Think back on a variety of different public presentations youve witnessedspeeches by fellow students, presentations by instructors, political debates, and so on. What is the most effective use of a...