Function for PatternCount Below:

function count = PatternCount(Text,Pattern)

count = 0;

for i = 0:length(Text) - length(Pattern)

substring = Text(i+1:i+length(Pattern));

if strcmp(substring,Pattern) == 1 count = count+1;

end

end

end

Pseudo Codes for rest of functions given below

ComputingFrequencies Function: Also create a function for PatternToNumber

Pattern = 'AATTT' % If needed for PatternCount

k-mer

k = 4

OriC of Vibrio Cholerea

VC = 'ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC'

Hw#2 (Due Feb 21) (1 point) Write a Matlab code for PatternCount algorithm. (1 point) Write a Matlab code for FrequentWords algorithm. (3 points) Run FrequentWords on the OriC of Vibrio Cholerea genome (uploaded on Beachboard) and fill out the following table 3 6 # times repeated k-mers (1 point) Write a Matlab code for ComputingFrequencies algorithm. (2 points) Run both algorithms on the OriC of Vibrio Cholerea and calculate their running times when we replicate OriC consecutively for 10 times. (1 point) Plot the running time results on a single figure. Are the results consistent with what you expect from the theoretical running time? Why? Hw#2 (Due Feb 21) (1 point) Write a Matlab code for PatternCount algorithm. (1 point) Write a Matlab code for FrequentWords algorithm. (3 points) Run FrequentWords on the OriC of Vibrio Cholerea genome (uploaded on Beachboard) and fill out the following table 3 6 # times repeated k-mers (1 point) Write a Matlab code for ComputingFrequencies algorithm. (2 points) Run both algorithms on the OriC of Vibrio Cholerea and calculate their running times when we replicate OriC consecutively for 10 times. (1 point) Plot the running time results on a single figure. Are the results consistent with what you expect from the theoretical running time? Why