Question: Given: FASTQ file Return: Corresponding FASTA records Sample Dataset @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !*((((***+))%%%++)(%%%%).1***-+*****))**55CCF>>>>>>CCCCCCC65 Sample Output >SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT Write code in python. Please answer as quickly

Given: FASTQ file

Return: Corresponding FASTA records

Sample Dataset

@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !*((((***+))%%%++)(%%%%).1***-+*****))**55CCF>>>>>>CCCCCCC65

Sample Output

>SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT

Write code in python. Please answer as quickly as possible.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Q:

Problem Statement: This question asks to write a script to obtain all protein sequences coded in the human genome in the multiple FASTA format, using the RefSeq table obtained from the UCSC Table...

Q:

A discrete sequence {xn} can be converted into a continuous representation x(t) = ts X n= (t n ts) xn, where ts is the sampling period. (a) State two characteristic properties of Dirac's function. [2...

Q:

Hi, please help me with the following question and code it in C++. And please if you are not getting the question don't answer it because I already received 4 incorrect answers and this is 5th time...

Q:

Hi, please help me with the following problem and please if you are not getting the question don't answer it. This question has a pre coded file that i am attaching the screenshots of that with this...

Q:

CS 112 Project 5 Dictionaries and File IO Due Date: Sunday, April 23rd, 11:59pm Last chance to use tokens! (P6 won't allow late submissions) The purpose of this assignment is to explore dictionaries...

Q:

Introduction In this assignment, you will write a program to recommend medical treatments based on the clinical attributes of a patient. You will be using the invasive Breast Carcinoma (BRCA) dataset...

Q:

Please answer quickly if possible!!!!! thank you!! Soccer Tournament Simulator (soccer_tournament.py) Your friend is a member of the UVM Women's Soccer Team and they have a tournament coming up....

Q:

Please solve for todo task4: In TODO 4, you will implement the export_phone_call_counts function that exports the output of the most_frequently_called function into a plain text file. The function...

Q:

can i get a solution to this question please. Value: Document (include your file name) 15% of final grade How to complete: 1. Read the following Anniversary Party scheduling problem: As the project...

Q:

Python and most Python libraries are free to download or use, though many users use Python through a paid service. Paid services help IT organizations manage the risks associated with the use of...

Q:

Maria Hernandez can still remember the concussion that ended her collegiate soccer career. It was during a practice drill for her team at Holy Methodist University , a member of the N.C.A.A. Having...

Q:

At maximum capacity of 100,000 units, the total unit cost of a certain product amounted to P80. Details are as follows: Variable costs P50 Fixed costs 30 Unit costs P80 What is the total unit costs...

Q:

LBO candidates with robust growth profiles have a greater likelihood of: Greater EBITDA multiple expansion Strong cash flow generation Increasing debt A lower P / E in the marketplace

Q:

Compared with half a century ago, adoption has become _ _ _ _ _ _ _ _ _ common, but it is more open and acceptabl e , so we probably discuss it _ _ _ _ _ _ _ . fill in the blanks more or much less or...

Q:

Use the short-run aggregate supply schedules below to answer the questions that follow: AS (P100) AS (P125) AS (P75) P Q P Q P Q 125 $280 125 $250 125 $310 100 250 100 220 100 280 75 220 75 190 75...

Q:

KEY QUESTION Consider the Security Market Line (SML). What determines its vertical intercept? What determines its slope? And what will happen to an assets price if it initially plots onto a point...

Q:

Suppose that work hours in New Zombie are 200 in year 1 and productivity is $8. What is New Zombies real GDP? If work hours increase to 210 in year 2 and productivity rises to $10, what is New...