Question: Given the sequence in the below FASTA sequence, find all kmers of size 2 to 4 ans answer the questions below. Kmer _ Find ATTTCTGCAACTCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAA

Given the sequence in the below FASTA sequence, find all kmers of size

2

4

ans

answer the questions below.

Kmer

_

Find

ATTTCTGCAACTCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAA

CCGCGGGCTGGGAATCTGAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCT

AACTATTCCCTGTGTCTTATAGGGGCCTGCGTTATCTGCCTGTCGAACCATAGGATTCGTGTCAGC

GCGC

Write and return a code in a language of your choice

(

python

)

that returns a table that displays their counts and positions. You may use compiled packages but the bulk of the code must be your own. Please add comments explaining what each step of your program does.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

need help with 2 python codes that perform the 3 functions stated below them 1. Write a Python code for PatternCount algorithm. 2- Write a Python code for FrequentWords algorithm. Once you finished...

the required functions are at the end for easy use. These are the functions required that I have coded. I am lost on how to contribute them into these new functions. Once the new functions are coded...

1. Select the answers that best complete the given statements. A sequence in which each term after the first is obtained by multiplying the preceding term by a fixed nonzero constant is called a/an...

5. Describe how linear functions and arithmetic sequences are similar. How are they different? Algebraic For the following exercises, find the common difference for the arithmetic sequence provided....

Question 1 12.5 pts Select the best answer from each dropdown menu. Examine this algorithm. Given a sequence A and an element e, this algorithm returns the smallest index of e in Sequence A if A...

NIDES Precalculus 12 Show ALL work for full marks. I encourage you to write out the formula FIRST then substitute. 3. What are the similarities and differences between of an arithmetic sequence and a...

The question is stated above. Supporting information is given below Question 5: bestLikenessScore () (8 points) Write a function called bestLikenessscore () that is going to find the best Likeness...

Mathematics Pre-Calculus 12 Unit 9 Self-Assessment 1. Graph the following on the grid provided. a ) (x + 2 ) + (1 - 3)2= 16 5 1-5 5 .... Self Assessment No Attempt = 0 Beginning = 1 Emerging = 2...

\fc) 4+69+.... r : I mark S = 2 marks . . . . . . 5 . . 4 23. The sum of an infinite geometric series 18 5 and the common ratio is . Find the first term. 23. 2 nmrks 24. A hard rubber ball is dropped...

. Name: calcLikenessscore () Parameters (Please Follow the same Order): segi (string) - The First Sequence seq2 (string) - The Second Sequence Return Value: The Likeness Score - likeness_score...

Country Y is an industrialized economy. The budget deficit of the government has been rising sharply in the last few years. In order to fund this expenditure, the government has resorted to financing...

Barnes Entertainment Corporation prepared a master budget for the month of November that was based on sales of 150,000 board games. The budgeted income statement for the period is as follows. During...

Under the Yariable Interest Entity consolidation method a company must own at least 5 0 % of an investment in order to consolidate the investment. True False

Questions 8-9. From experience, it is known that 70% of one-year-old children can distinguish their mother's voice from the voice of a similar sounding female. A random sample of nine one-year-olds...

Flexibility. Organizations are introducing new working patterns and abandoning some traditional ones, influenced by economic transformation and savings in labour costs; however, part-time working has...

Recruitment and redundancy. Skills shortages as a result of loss of employees and lower wages in the state- and former state-owned organizations has led to targeting of school leavers, the long-term...

Underestimation of the complexities of a free market, with a tendency to rely on imported solutions. Western managers, they recommend, should encourage a blend of HRM involving both free market...