HELP URGENT

NEED PYTHON CODE

The CG island is a short stretch of DNA in which the frequency of the CG sequence is higher than other regions. It is also called the CpG island, where "p" simply indicates that "C" and "G" are connected by a phosphodiester bond.

CpG islands are often located around the promoters of housekeeping genes (which are essential for general cell functions) or other genes frequently expressed in a cell. At these locations, the CG sequence is not methylated. By contrast, the CG sequences in inactive genes are usually methylated to suppress their expression.

Two models are given in wich the observation (+) is tested against the null hypothesis (-):

M1 the (+) model (ISLAND)

M2 the (-) model (NON ISLAND)

For M1 we have: S1 = ATCGATTCGATATCATACACGTAT, known to belong to a CpG island. For M2 we have: S2 = CTCGACTAGTATGAAGTCCACGCTTG, known to belong to other regions in the genome. Follow the steps below to implement a software application: 1. for the CpG+ model: Count the transition frequencies from the known sequence "S1" which does belong to a CpG island. 2. for the CpG- model: Also count the transition frequencies from the sequence "S2" which does not belong to a CpG island. 3. Make the log likelihood matrix:

log-likelihood=log2(TrstTst+) ote: on how to take log of any base if the log function of your log2(0.6)=ln(2)ln(0.6)log2(0.6)=0.7369