4) You have decided to focus your efforts on patient 2 and patient 5, since there...

Transcribed Image Text:

4) You have decided to focus your efforts on patient 2 and patient 5, since there are no documented cases of patients with Tay Sachs that completely lack HEXAa expression. You decide to clone and sequence the promoter region of the HEXAa gene from patient 2 and you get the results shown below. Normal Gene 5'- GCTAGCTCCAATCTTGGCATGGGGCCGGGCCCGGATGTTACGTTATAAGCTAGTCA-3' Mutant Gene 5'- GCTAGCTCCAATCTTGGCATGGGGCCGGGCCCGGATGTTACGTGATAAGCTAGTCA-3' a) Label three important sequences commonly found in the proximal promoter of a eukaryotic gene. Identify the mutation in the mutant gene sequence and explain the significance of this mutation in detail. Be sure to include why this mutation would result in the production of no RNA and no protein b) Next, you clone and sequence the HEXAa gene from patient 5 and you find a mutation in the 5'-UTR region of the gene. Suggest a possible mutation and discuss how this mutation would explain the results obtained in the Western and Northern blots above. 4) You have decided to focus your efforts on patient 2 and patient 5, since there are no documented cases of patients with Tay Sachs that completely lack HEXAa expression. You decide to clone and sequence the promoter region of the HEXAa gene from patient 2 and you get the results shown below. Normal Gene 5'- GCTAGCTCCAATCTTGGCATGGGGCCGGGCCCGGATGTTACGTTATAAGCTAGTCA-3' Mutant Gene 5'- GCTAGCTCCAATCTTGGCATGGGGCCGGGCCCGGATGTTACGTGATAAGCTAGTCA-3' a) Label three important sequences commonly found in the proximal promoter of a eukaryotic gene. Identify the mutation in the mutant gene sequence and explain the significance of this mutation in detail. Be sure to include why this mutation would result in the production of no RNA and no protein b) Next, you clone and sequence the HEXAa gene from patient 5 and you find a mutation in the 5'-UTR region of the gene. Suggest a possible mutation and discuss how this mutation would explain the results obtained in the Western and Northern blots above.

Answer rating: 100% (QA)

a We know that there are 3 main promoters identified in the eukaryotic gene They are 1 TATA box 2 th... View the full answer