Question: HW 1 0 - Challenge Problem - RNA Structure Prediction 1 . Given an RNA sequence, such as ACAGU, we can predict its secondary structure
HW Challenge Problem RNA Structure Prediction Given an RNA sequence, such as ACAGU, we can predict its secondary structure by tagging each nucleotide as or Each matching pair of must be AU GC or GU or their mirror symmetries: UA CG UG We also assume pairs can not cross each other. The following are valid structures for ACAGU: ACAGU We want to find the structure with the maximum number of matching pairs. In the above example, the last structure is optimal pairs bestACAGU Tiebreaking: arbitrary. Don't worry as long as your structure is one of the correct best structures. the program does not pass all test some other cases more cases at the bottom: GCACG UUCAGGA GUUAGAGUCU AUAACCUUAUAGGGCUCUG AACCGCUGUGUCAAGCCCAUCCUGCCUUGUU GAUGCCGUGUAGUCCAAAGACUUCACCGUUGG CAUCGGGGUCUGAGAUGGCCAUGAAGGGCACGUACUGUUU ACGGCCAGUAAAGGUCAUAUACGCGGAAUGACAGGUCUAUCUAC AGGCAUCAAACCCUGCAUGGGAGCACCGCCACUGGCGAUUUUGGUA Total number of all possible structures totalACAGU kbest structures: output the best, ndbest, kthbest structures. kbestACAGU The list must be sorted. Tiebreaking: arbitrary. In case the input k is bigger than the number of possible structures, output all. Sanity check: kbests bests for each RNA sequence s
Step by Step Solution
There are 3 Steps involved in it
1 Expert Approved Answer
Step: 1 Unlock
Question Has Been Solved by an Expert!
Get step-by-step solutions from verified subject matter experts
Step: 2 Unlock
Step: 3 Unlock
