If you were verifying the cloning of the gene that contains the vector, which of the...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
If you were verifying the cloning of the gene that contains the vector, which of the three amplifications would be your best test and why? Primer Sequence (5'-3) Product (pb) M13F_pUC AGCGGATAACAATTTCACACAGG M13R_pUC CCCAGTCACGACGTTGTAAAACG 2604 2 TagF GGGATGCTGCCCCTCTTTGAGCCC TaqR TCACTCCTTGGCGGAGAGCCAGTCC 2492 AmpF ATGAGTATTCAACATTTCCGTGTCG AmpR TTACCAATGCTTAATCAGTGAGGC 860 2500 2.750 2000 Taq polymerase * JaqR (3604) M13R pUC (3676) TagF (1112) M13F pUC (1072)- PAK Taq. 7,043 bp lati AmpR (3873) AmpR siso doo Ampf (6013) cog's ost 3. If you were verifying the cloning of the gene that contains the vector, which of the three amplifications would be your best test and why? Primer Sequence (5'-3) Product (pb) M13F_pUC AGCGGATAACAATTTCACACAGG M13R_pUC CCCAGTCACGACGTTGTAAAACG 2604 2 TagF GGGATGCTGCCCCTCTTTGAGCCC TaqR TCACTCCTTGGCGGAGAGCCAGTCC 2492 AmpF ATGAGTATTCAACATTTCCGTGTCG AmpR TTACCAATGCTTAATCAGTGAGGC 860 2500 2.750 2000 Taq polymerase * JaqR (3604) M13R pUC (3676) TagF (1112) M13F pUC (1072)- PAK Taq. 7,043 bp lati AmpR (3873) AmpR siso doo Ampf (6013) cog's ost 3.
Expert Answer:
Answer rating: 100% (QA)
taq primer amplifier sequence is best to verifying the cloning of the gene that contains the vector Reason Taq polymerase denotes the heatstable DNA p... View the full answer
Posted Date:
Students also viewed these biology questions
-
Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the techniques of dideoxy DNA sequencing or...
-
If a gene contains three introns, draw what it would look like in an R loop experiment.
-
The gene encoding the beta subunit of RNA polymerase from Escherichia coli is said to be orthologous to the rpoB gene of Bacillus subtilis. What does that mean about the relationship between the two...
-
According to a study conducted by the Gallup organization, the proportion of Americans who are afraid to y is 0.10. A random sample of 1100 Americans results in 121 indicating that they are afraid to...
-
The 2011 annual report of the University of Washington includes information about its receivables from student loans in a footnote to the financial statements ($ in thousands): 1. Compare the quality...
-
A block of mass 0.450 kg is attached to one end of a cord of mass 0.003 20 kg; the other end of the cord is attached to a fixed point. The block rotates with constant angular speed in a circle on a...
-
When a company wants to reduce the market price per share of its stock, what action should it take? a. Issue a cash dividend b. Issue a stock dividend c. Do a reverse stock split d. Do a forward...
-
Rob Judson Company had the following transactions involving notes payable. July 1, 2010 Borrows $50,000 from Third National Bank by signing a 9-month, 12% note. Nov. 1, 2010 Borrows $60,000 from...
-
the questions asked below and give concrete and detailed examples. Pick an organization with which you are familiar. It can be an organization in which you have worked or currently work or one that...
-
The following graph shows the market for loanable funds in a dosed economy. The upward-sloping orange line represents the supply of loanable funds, and the downward-sloping blue line represents the...
-
Jasper Ltd is a retailer and has the following transactions in the quarter ended 31 March 2022: Supplies made (excluding VAT) How much input tax can Jasper Ltd recover for the quarter ended 31 March...
-
The laws of many countries protect women from job discrimination, but others do not offer women such protection. Suppose several important job opportunities arise at overseas factories owned by your...
-
11. How can international businesspeople avoid relying on the self-reference criterion when dealing with people from other cultures?
-
The UK and Poland both produce cakes and coats. Suppose that a UK worker can produce 50 cakes per hour or 1 coat per hour. Suppose that a Polish worker can produce 40 cakes per hour or 2 coats per...
-
Distinguish between ethical and unethical behavior.
-
Lovers of opera persuade the government to impose a price ceiling of 50 per ticket at the countrys national opera house. Does this policy get more or fewer people to attend? What does the market...
-
Activity 1 Instructions: Answer the following questions. Use a separate sheet of paper, and do not forget to write your complete name. 1. Define forecasting and give reasons why organizations need to...
-
Show that, given a maximum flow in a network with m edges, a minimum cut of N can be computed in O(m) time.
-
Colin Agee, chairperson of the board of directors and chief executive officer of Image, Inc., is pondering a recommendation to make to the firm's board of directors in response to actions taken by...
-
Your neighbor, Norman Vetter, has always been tinkering in his garage with his inventions. He believes he has finally come up with one that could really sell well. He is a little concerned about some...
-
Indicate whether each of the cost control methods listed in a through \(f\) is (1) preventive, (2) corrective, or (3) diagnostic. a. Preparation of an annual production budget of variable and fixed...
Study smarter with the SolutionInn App