Question: Implement the pattern-matching algorithm shown in the pseudo-code listing below. The 'slist' object in the pseudo-code is a map data structure. Most listings of this
Implement the pattern-matching algorithm shown in the pseudo-code listing below. The 'slist' object in the pseudo-code is a map data structure. Most listings of this algorithm's use arrays, however, a map is much more space efficient.
Your map data structure is your dynamic-array, converted to a map that takes
This algorithm expects unique strings of length 1 (the lower ascii table). Test your implementation using a range of text strings and patterns. For testing purposes, assume the strings are unique and you do not need to check for uniqueness.
A second test would be to test unique strings of length > 1. Note that a unique string is a string that contains unique characters not present in other strings. For example:
See algorithms below for pseudo-code. Also, the uploaded sample code for Rabin-Karp (RabinKarp.cpp), has a bug in the implementation: sometimes it finds a match, and sometimes it doesn't. It should always find it, as it's a character-by-character crawler. Part 2 of this assignment is to fix bug, so it finds it in all cases.
Pseudo Code:
Algorithm Position(c, s, t) 1 for o = len(t)+1 to 1 dec o 2 f = true 3 for i = 0 to len(s) step i 4 it = o - len(s) - 1 + i 5 if it >= 0 and s[i] != t[it] 6 f = false 7 it = o - len(s) - 1 8 if f == true and (it<=0 or t[it-1] ne c) 9 return len(t) - o + 1 10 return -1 Algorithm BadShift(p) 1 for x = 0 to len(p)-1 step 1 2 slist[p[x]] = len(p) - x - 1 Algorithm GoodShift(k) 1 b = "" 2 for i = 0 to len(k) step 1 3 slist[len(b)] = Position(k[len(k) - 1 - i],b,k) 4 b = k[len(k) - 1 - i] + b 5 return slist Algorithm Search(t,p) 1 g = GoodShift(p) 2 b = BadShift(p) 3 while i < len(t) - len(p) + 1 4 j = len(p) 5 while j > 0 && p[j-1] == t[i+j-1] 6 j -= 1 7 if j > 0 8 bs = b[t[i+j-1]] 9 gs = g[len(p)-j] 10 if bs > gs 11 i += bs 12 else 13 i += gs 14 else 15 return i 16 return -1 Algorithm Test() 1 target = "block of text ..." 2 pattern = "some pattern" 3 Search(target,pattern)
Rabin Karp.cpp:
#include
#include
#include
#include
#include
#include
#include "ConsoleColor.h"
using namespace std;
// the number of characters in input alphabet
#define ascii 128 // lower ascii
// utility
void Output(string stext, int startindex)
{
for (int i = 0; i < stext.length(); i++)
{
if (i < startindex)
cout << yellow << stext[i];
else
cout << red << stext[i];
}
cout << white << endl;
}
// A linear approach: Seach character by character
void BruteForce(string pattern, string text)
{
int ncompares = 0;
for (int i = 0; i < text.length(); i++)
{
Output(text, i);
int j = 0;
for (; j < pattern.length(); j++)
{
ncompares++;
if (text[i + j] != pattern[j])
break;
}
if (j == pattern.length())
{
cout << cyan << "Pattern found at index " <<
i << endl;
}
}
cout << white << "BruteForce compares = " << ncompares << endl;
}
// Optimized BF: skips some characters when match is found
void BFOptimized(string pattern, string text)
{
int ncompares = 0;
int M = pattern.length()-1;
for (int i = 0; i < text.length(); i++)
{
Output(text, i);
ncompares++;
if (text[i] == pattern[0])
{
ncompares++;
if ((i + M) > text.length())
break;
if (text[i + M] == pattern[M])
{
bool bfound = true;
for (int j = 1; j < M; j++)
{
ncompares++;
if (text[i + j] !=
pattern[j])
{
bfound = false;
break;
}
}
if (bfound)
{
cout << cyan << "Pattern
found at index " << i << endl;
i += M;
}
}
}
}
cout << white << "BFOptimized compares = " << ncompares << endl;
}
// Optimized BF Skip: skips based first character match
void BFSkip(string pattern, string text)
{
int ncompares = 0;
int i = 0;
while (i < text.length())
{
Output(text, i);
ncompares++;
if (text[i] == pattern[0])
{
ncompares++;
int bskip = i;
if (i + pattern.length() > text.length())
break;
if (text[i + pattern.length()] ==
pattern[pattern.length()-1])
{
bool bfound = true;
for (int j = 1; j < pattern.length();
j++)
{
ncompares++;
if (text[i + j] !=
pattern[j])
{
bfound = false;
i++;
break;
}
}
if (bfound)
{
cout << cyan << "Pattern
found at index " << i << endl;
i += pattern.length();
}
}
else
i = bskip + pattern.length();
}
else
i++;
}
cout << white << "BFSkip compares = " << ncompares << endl;
}
void computeTF(string pattern, vector
{
int state = 0;
cout << cyan << "Table" << endl;
for (int state = 0; state <= pattern.length(); ++state)
{
TF[state][pattern[state]] = state + 1;
cout << cyan << "{" << state << "," <<
TF[state][pattern[state]] << "}" << endl;
}
}
void FiniteAutomata(string pattern, string target)
{
vector
computeTF(pattern, TF);
int ncompares = 0;
int state = 0;
for (int i = 0; i < target.length(); i++)
{
Output(target, i);
state = TF[state][target[i]];
ncompares++;
if (state == pattern.length())
cout << cyan << "Pattern found at index " <<
i - pattern.length() + 1 << endl;
}
cout << white << "Finite Automata compares = " << ncompares << endl;
}
void RabinKarp(string pattern, string text, int prime)
{
int ncompares = 0;
int jndex = 0;
int phash = 0; // hash value for pattern
int thash = 0; // hash value for txt
int hash = 1;
// The value of h would be "pow(d, M-1)%q"
hash = int(pow(ascii, pattern.length() - 1)) % prime;
if (hash < 0)
hash = hash + prime;
// Calculate the hash value of pattern and first window of text
for (int index = 0; index < pattern.length(); index++)
{
phash = (ascii * phash + pattern[index]) % prime;
thash = (ascii * thash + text[index]) % prime;
}
cout << cyan << "hash = " << hash << '\t';
cout << cyan << "phash = " << phash << '\t';
cout << cyan << "thash = " << thash << endl;
for (int index = 0; index <= text.length() - pattern.length();
index++)
{
ncompares++;
Output(text, index);
if (phash == thash)
{
for (jndex = 0; jndex < pattern.length();
jndex++)
{
if (text[index + jndex] !=
pattern[jndex])
break;
}
if (jndex == pattern.length())
cout << white << "Pattern found at
index " << index << endl;
}
if (index < (text.length() - pattern.length()))
{
thash = (ascii * (thash - text[index] * hash)
+ text[index + pattern.length()]) % prime;
if (thash < 0)
thash = (thash + prime);
cout << cyan << "text hash " << thash <<
endl;
}
}
cout << white << "RabinKarp compares = " << ncompares << endl;
}
void preKMP(string pattern, vector
{
int m = pattern.length();
prefix[0] = -1;
for (int i = 1; i { int p = prefix[i - 1]; while (p >= 0) { if (pattern[p] == pattern[i - 1]) break; else p = prefix[p]; } prefix[i] = p + 1; } for (int i = 0; i cout << cyan << "index " << i << " skip " << prefix[i] << endl; } void KMP(string pattern, string target) { vector preKMP(pattern, prefix); int index = 0; int pat = 0; int ncompares = 0; while (index < target.length()) { Output(target, index); if (pat == -1) { index++; pat = 0; } else if (target[index] == pattern[pat]) { index++; pat++; if (pat == pattern.length()) { cout << cyan << "Found index at " << pat - pattern.length() << endl; pat = 0; } } else { pat = prefix[pat]; ncompares++; } } cout << white << "KMP compares " << ncompares << endl; } void main() { //string text = "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCGCCCTGCCCCTG GAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGAC TTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCACACAGTCCTCATAGGAGAGGAAGCT CGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAA CTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGAC CTGAA"; //string pattern = "ACACAGT"; //cout << "Text length " << text.length() << endl; //cout << purple << "BruteForce ========== "; //BruteForce(pattern, text); //cout << purple << "BFOptimized ========== "; //BFOptimized(pattern, text); //cout << purple << "BFSkip ========== "; //BFSkip(pattern, text); //cout << purple << "FiniteAutomata ========== "; //FiniteAutomata(pattern, text); //cout << purple << "RabinKarp ========== "; //string rtext = " Blvd>, //string rpattern = "Cupertino"; //string rtext = "ACATACGACACAGT"; //string rpattern = "CAGT"; //int prime = 157; // A prime number //RabinKarp(rpattern, rtext, prime); string ktext = "ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCGCCCTGCCCCTG GAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGAC TTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCACACAGTCCTCATAGGAGAGGAAGCT CGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAA CTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGAC CTGAA"; string kpattern = "ACACAGT"; cout << purple << "KMP ========== "; KMP(kpattern, ktext); } ConsoleColor.h: #pragma once #include #include using namespace std; enum COLOR { // Text foreground colors // Standard text colors GRAY_TEXT = 8, BLUE_TEXT, GREEN_TEXT, CYAN_TEXT, RED_TEXT, MAGENTA_TEXT, YELLOW_TEXT, WHITE_TEXT, // Faded text colors BLACK_TEXT = 0, BLUE_FADE_TEXT, GREEN_FADE_TEXT, CYAN_FADE_TEXT, RED_FADE_TEXT, MAGENTA_FADE_TEXT, YELLOW_FADE_TEXT, WHITE_FADE_TEXT, // Standard text background color GRAY_BACKGROUND = GRAY_TEXT << 4, BLUE_BACKGROUND = BLUE_TEXT << 4, GREEN_BACKGROUND = GREEN_TEXT << 4, CYAN_BACKGROUND = CYAN_TEXT << 4, RED_BACKGROUND = RED_TEXT << 4, MAGENTA_BACKGROUND = MAGENTA_TEXT << 4, YELLOW_BACKGROUND = YELLOW_TEXT << 4, WHITE_BACKGROUND = WHITE_TEXT << 4, // Faded text background color BLACK_BACKGROUND = BLACK_TEXT << 4, BLUE_FADE_BACKGROUND = BLUE_FADE_TEXT << 4, GREEN_FADE_BACKGROUND = GREEN_FADE_TEXT << 4, CYAN_FADE_BACKGROUND = CYAN_FADE_TEXT << 4, RED_FADE_BACKGROUND = RED_FADE_TEXT << 4, MAGENTA_FADE_BACKGROUND = MAGENTA_FADE_TEXT << 4, YELLOW_FADE_BACKGROUND = YELLOW_FADE_TEXT << 4, WHITE_FADE_BACKGROUND = WHITE_FADE_TEXT << 4 }; inline ostream& purple(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, MAGENTA_TEXT); return s; } inline ostream& cyan(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, CYAN_TEXT); return s; } inline ostream& backblue(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, CYAN_TEXT | BLUE_BACKGROUND); return s; } inline ostream& blue(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, BLUE_TEXT); return s; } inline ostream& red(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, RED_TEXT); return s; } inline ostream& green(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, GREEN_TEXT); return s; } inline ostream& yellow(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, YELLOW_TEXT); return s; } inline ostream& white(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, WHITE_TEXT); return s; } inline ostream& backwhite(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, WHITE_FADE_BACKGROUND); return s; } // experimental inline ostream& orange(ostream &s) { HANDLE hStdout = GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute(hStdout, YELLOW_FADE_TEXT); return s; } struct color { color(WORD attribute) : m_color(attribute) { }; WORD m_color; ostream& operator()(ostream& os) { return os; } }; template basic_ostream<_Elem,_Traits>& operator<<(basic_ostream<_Elem,_Traits>& s, color& c) { HANDLE hStdout=GetStdHandle(STD_OUTPUT_HANDLE); SetConsoleTextAttribute( hStdout, c.m_color ); return s; }
Step by Step Solution
There are 3 Steps involved in it
Get step-by-step solutions from verified subject matter experts
