in python language

Problem The GC-content of a DNA string is given by the percentage of symbols in the string that are 'C' or 'G'. For example, the GC-content of AGCTATAG' is 37.5%. Note that the reverse complement of any DNA string has the same GC-content. DNA strings must be labeled when they are consolidated into a database. A commonly used method of string labeling is called FASTA format. In this format, the string is introduced by a line that begins with '>, followed by some labeling information. Subsequent lines contain the string itself, the first line to begin with '>' indicates the label of the next string, In Rosalind's implementation, a string in FASTA format will be labeled by the ID "Rosalind_xxxx", where *xxxx denotes a four-digit code between 0000 and 9999. Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each). Return: The ID of the string having the highest GC- content, followed by the GC-content of that string. Rosalind allows for a default error of 0.001 in all decimal answers unless otherwise stated, please see the note on absolute error below. Sample Dataset >Rosalind_6404 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTT TCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG >Rosalind_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTA TCCAGGCGCTCCGCCGAAGGTCT ATATCCATTTGTCAGCAGACACGC >Rosalind_0808 CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGA GAACGCTTCAGACCAGCCCGGAC TGGGAACCTGCGGGCAGTAGGTGGAAT Rosalind_0808 60.919540 4. Instead of reading multiple FASTA strings as described in the Rosalind problem, read one line of text via the input() function, and assume it contains a DNA string. a. You may pass a prompt argument to input (), if you'd like. If you do, make sure it doesn't contain any numeric characters or periods. b. A Any non-A/C/G/T input characters shall be ignored. 5. Use the print] function to print one line to standard output, containing the GC-content of the DNA, rounded to three digits after the decimal point. Do not include any other decimal digits or periods in this line, but otherwise the formatting is up to you