In the spreadsheet, you will find data on the returns of Berkshire Hathaway, the returns of its
Fantastic news! We've Found the answer you've been seeking!
Question:
In the spreadsheet, you will find data on the returns of Berkshire Hathaway, the returns of its portfolio of public stocks (computed via Berkshire's 13F filings to the SEC), several factor returns, and the returns of Heinz and Kraft. Compute the factor loadings and annualized alpha of Berkshire Hathaway with respect to the following factor models and interpret the results:
- The 1-factor market model.
- The Fama-French 3-factor model with SMB and HML
- The 5-factor model consisting of the FF 3-factor model augmented with BAB and QMJ.
how do run regressions on this information, what formula and data columns do use
Transcribed Image Text:
Date 19761029 19761130 19761231 19770131 19770228 19770331 19770429 19770531 19770630 19770729 19770831 19770930 19771031 19771130 19771230 19780131 19780228 19780331 19780428 19780531 19780630 19780731 19780831 19780929 19781031 19781130 19781229 19790131 19790228 19790330 19790430 19790531 19790629 19790731 19790831 19790928 19791031 10701120 Total returns Source: Frazzini, Kabiller, and Pedersen (Financial Analysts Berkshire Public stocks Heinz, total Kraft, total return Hathaway, return from 13F, total return total return 0.15441 0.14650 0.00000 0.00000 0.07778 -0.01031 0.06250 0.00000 0.00000 0.01961 0.04327 0.04148 0.08850 0.15041 -0.03180 0.00365 0.00000 0.10546 0.15132 -0.02857 0.00000 0.04412 0.00000 0.06197 -0.09284 -0.08187 0.01911 0.01875 0.14724 0.03743 0.00000 0.19845 0.35484 0.12698 -0.02817 -0.17391 012281 0.04464 0.15880 -0.05205 0.02745 -0.06718 -0.02479 0.00000 0.13729 0.06015 -0.02837 0.06891 -0.03448 -0.00714 0.03914 0.00000 0.01399 -0.01655 0.09929 -0.03226 0.05733 0.02548 0.04969 0.00473 -0.12798 0.03072 0.06623 0.03145 -0.07622 0.06931 0.04063 -0.08408 0.01639 -0.01634 0.06645 0.07913 -0.12866 0.00671 Returns in excess of rf (compute yourself) Berkshire Public stocks Hathaway, from 13F, excess excess return return Heinz, Kraft, excess return excess return rf MKT (excess return) 0.00410 0.00400 0.00400 0.00360 0.00350 0.00380 0.00380 0.00370 0.00400 0.00420 0.00440 0.00430 0.00490 0.00500 0.00490 0.00490 0.00460 0.00530 0.00540 0.00510 0.00540 0.00560 0.00560 0.00620 0.00680 0.00700 0.00780 0.00770 0.00730 0.00810 0.00800 0.00820 0.00810 0.00770 0.00770 0.00830 0.00870 Source: Fama French SMB 0.00000 -0.02420 0.00360 0.05650 -0.04050 -0.01950 -0.01370 0.00150 -0.01460 0.04710 -0.01690 -0.01750 -0.00270 -0.04380 0.04000 0.00270 -0.06010 -0.01380 0.02850 0.07880 0.01760 -0.01690 0.05110 0.03750 -0.01430 -0.11910 0.02710 0.00880 0.04230 -0.03560 0.05680 -0.00060 -0.02210 0.03850 0.00820 0.05530 -0.00820 -0.08100 0.05210 0.00250 0.02320 0.03010 0.04780 0.01090 0.00990 -0.00120 0.01180 0.02120 0.02120 0.01530 0.01440 0.01270 0.03710 0.01330 0.02210 0.03580 0.03470 0.00400 0.04560 0.01700 0.00260 0.05070 -0.00390 -0.09880 0.03010 0.01250 0.03680 0.00460 0.03180 0.02160 0.00560 0.01170 0.01270 0.02080 -0.00250 -0.03330 0.02750 HML -0.00130 0.01510 0.02220 0.04260 0.00500 0.01020 0.03450 0.00840 -0.00640 -0.00600 -0.02800 -0.00480 0.01710 0.00320 -0.00350 0.03320 0.00780 0.01230 -0.03550 -0.00620 0.00580 -0.01120 -0.00460 0.01870 0.01360 -0.02220 -0.02190 0.02250 0.01180 -0.00670 0.01070 0.01930 0.01470 0.01700 -0.01550 -0.00870 -0.01860 0.02250 QMJ 0.00029 -0.02004 -0.00628 -0.02040 0.01623 -0.00749 -0.01803 -0.00350 -0.00548 0.01083 0.02675 0.00520 0.01116 -0.00322 0.00264 -0.01412 -0.00076 -0.01792 0.02751 0.00476 -0.00413 0.01176 0.00111 -0.00739 0.03846 -0.00724 0.02376 -0.03170 -0.00535 -0.01630 0.00600 -0.01324 -0.02317 0.00458 0.01144 0.00341 0.02438 003508 Source: AQR BAB 0.00982 0.00381 0.03267 0.03833 0.02870 0.01391 0.01006 0.01310 -0.00333 0.02715 0.00075 0.00525 0.00302 -0.00109 0.02138 -0.00150 0.01440 0.01336 0.03034 0.01862 0.02012 0.00408 0.03983 0.02170 -0.02782 -0.04489 0.00227 0.03618 0.01148 -0.01652 0.01033 -0.00156 0.01439 0.01414 0.02059 0.00574 -0.04565 001527 UMD -0.00480 0.02900 0.00770 0.03980 0.00380 0.00480 0.04240 0.02030 0.01780 0.00310 -0.01770 0.02050 -0.00120 0.02200 0.01560 -0.00720 0.01900 0.01370 0.00850 0.02850 0.02780 0.04230 0.02820 -0.03110 -0.08380 0.05530 0.03040 -0.01270 -0.01050 0.02890 0.00800 -0.00210 0.00830 -0.01090 -0.00250 0.05320 0.02150 0.07060 Date 19761029 19761130 19761231 19770131 19770228 19770331 19770429 19770531 19770630 19770729 19770831 19770930 19771031 19771130 19771230 19780131 19780228 19780331 19780428 19780531 19780630 19780731 19780831 19780929 19781031 19781130 19781229 19790131 19790228 19790330 19790430 19790531 19790629 19790731 19790831 19790928 19791031 10701120 Total returns Source: Frazzini, Kabiller, and Pedersen (Financial Analysts Berkshire Public stocks Heinz, total Kraft, total return Hathaway, return from 13F, total return total return 0.15441 0.14650 0.00000 0.00000 0.07778 -0.01031 0.06250 0.00000 0.00000 0.01961 0.04327 0.04148 0.08850 0.15041 -0.03180 0.00365 0.00000 0.10546 0.15132 -0.02857 0.00000 0.04412 0.00000 0.06197 -0.09284 -0.08187 0.01911 0.01875 0.14724 0.03743 0.00000 0.19845 0.35484 0.12698 -0.02817 -0.17391 012281 0.04464 0.15880 -0.05205 0.02745 -0.06718 -0.02479 0.00000 0.13729 0.06015 -0.02837 0.06891 -0.03448 -0.00714 0.03914 0.00000 0.01399 -0.01655 0.09929 -0.03226 0.05733 0.02548 0.04969 0.00473 -0.12798 0.03072 0.06623 0.03145 -0.07622 0.06931 0.04063 -0.08408 0.01639 -0.01634 0.06645 0.07913 -0.12866 0.00671 Returns in excess of rf (compute yourself) Berkshire Public stocks Hathaway, from 13F, excess excess return return Heinz, Kraft, excess return excess return rf MKT (excess return) 0.00410 0.00400 0.00400 0.00360 0.00350 0.00380 0.00380 0.00370 0.00400 0.00420 0.00440 0.00430 0.00490 0.00500 0.00490 0.00490 0.00460 0.00530 0.00540 0.00510 0.00540 0.00560 0.00560 0.00620 0.00680 0.00700 0.00780 0.00770 0.00730 0.00810 0.00800 0.00820 0.00810 0.00770 0.00770 0.00830 0.00870 Source: Fama French SMB 0.00000 -0.02420 0.00360 0.05650 -0.04050 -0.01950 -0.01370 0.00150 -0.01460 0.04710 -0.01690 -0.01750 -0.00270 -0.04380 0.04000 0.00270 -0.06010 -0.01380 0.02850 0.07880 0.01760 -0.01690 0.05110 0.03750 -0.01430 -0.11910 0.02710 0.00880 0.04230 -0.03560 0.05680 -0.00060 -0.02210 0.03850 0.00820 0.05530 -0.00820 -0.08100 0.05210 0.00250 0.02320 0.03010 0.04780 0.01090 0.00990 -0.00120 0.01180 0.02120 0.02120 0.01530 0.01440 0.01270 0.03710 0.01330 0.02210 0.03580 0.03470 0.00400 0.04560 0.01700 0.00260 0.05070 -0.00390 -0.09880 0.03010 0.01250 0.03680 0.00460 0.03180 0.02160 0.00560 0.01170 0.01270 0.02080 -0.00250 -0.03330 0.02750 HML -0.00130 0.01510 0.02220 0.04260 0.00500 0.01020 0.03450 0.00840 -0.00640 -0.00600 -0.02800 -0.00480 0.01710 0.00320 -0.00350 0.03320 0.00780 0.01230 -0.03550 -0.00620 0.00580 -0.01120 -0.00460 0.01870 0.01360 -0.02220 -0.02190 0.02250 0.01180 -0.00670 0.01070 0.01930 0.01470 0.01700 -0.01550 -0.00870 -0.01860 0.02250 QMJ 0.00029 -0.02004 -0.00628 -0.02040 0.01623 -0.00749 -0.01803 -0.00350 -0.00548 0.01083 0.02675 0.00520 0.01116 -0.00322 0.00264 -0.01412 -0.00076 -0.01792 0.02751 0.00476 -0.00413 0.01176 0.00111 -0.00739 0.03846 -0.00724 0.02376 -0.03170 -0.00535 -0.01630 0.00600 -0.01324 -0.02317 0.00458 0.01144 0.00341 0.02438 003508 Source: AQR BAB 0.00982 0.00381 0.03267 0.03833 0.02870 0.01391 0.01006 0.01310 -0.00333 0.02715 0.00075 0.00525 0.00302 -0.00109 0.02138 -0.00150 0.01440 0.01336 0.03034 0.01862 0.02012 0.00408 0.03983 0.02170 -0.02782 -0.04489 0.00227 0.03618 0.01148 -0.01652 0.01033 -0.00156 0.01439 0.01414 0.02059 0.00574 -0.04565 001527 UMD -0.00480 0.02900 0.00770 0.03980 0.00380 0.00480 0.04240 0.02030 0.01780 0.00310 -0.01770 0.02050 -0.00120 0.02200 0.01560 -0.00720 0.01900 0.01370 0.00850 0.02850 0.02780 0.04230 0.02820 -0.03110 -0.08380 0.05530 0.03040 -0.01270 -0.01050 0.02890 0.00800 -0.00210 0.00830 -0.01090 -0.00250 0.05320 0.02150 0.07060
Expert Answer:
Answer rating: 100% (QA)
Computed Factor Loadings and annualized alpha results a 1Factor Market Model Annualized Alpha 003 Beta Market 12 b FamaFrench 3Factor Model Annualized Alpha 0025 Betas Market SMB HML 10 05 08 c 5Facto... View the full answer
Related Book For
Statistics For Business Decision Making And Analysis
ISBN: 9780321890269
2nd Edition
Authors: Robert Stine, Dean Foster
Posted Date:
Students also viewed these finance questions
-
In the paper, "Drink and Be Merry? Gender, Life Satisfaction, and Alcohol Consumption Among College Students" (Psychology of Addictive Behaviors, Vol. 19, Issue 2, pp. 184-191), J. Murphy et al....
-
Do the following analysis using the hypothetical data in Table 13.7. In this imaginary experiment, participants were randomly assigned to receive either no caffeine (1) or 150 mg of caffeine (2); and...
-
Creativity and Innovation Management (Feb. 2008) published an article on identifying the social network characteristics of lead users of children's computer games. Data were collected for n = 326...
-
Indicate whether each of the following items is considered a for AGI, (above-the line) deduction for the 2016 tax year. a. Student loan interest. b. Gambling losses. c. Early withdrawal penalty. d....
-
Show how an Estop command flows through the refined class structure described in Fig. 1.19, moving from a change on the front panel to the required changes on the train: a. Show it in the form of a...
-
Differentiate the functions of coupling, clutch, and brake.
-
Review the chapter's opening feature involving Matt Hofmann and his company, Westland Distillery. Assume that the company currently has net sales of $8,000,000 and that it is planning an expansion...
-
Discussion questions: With reference to the reading explain what Wolf means by a sane deep self. Do you think that Jojo is morally responsible (viz., deserving of praise and blame for his actions)?...
-
Queue Problem for any company Describe the business and share necessary information. Research queuing systems and discuss what type of queue they are using and why it is ineffective. You need to name...
-
A researcher identified a mutation in PR of phage that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer.
-
A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...
-
L ets suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region that is usually 300350 bp in length. The nucleosome structure is the same as in other eukaryotes. If...
-
In the replica-plating experiments of the Lederbergs, bacterial colonies appeared at the same locations on each of two secondary plates because a. T1 phage caused the mutations to happen. b. the...
-
Mexican hairless dogs have little hair and few teeth. When a Mexican hairless is mated to another breed of dog, about half of the puppies are hairless. When two Mexican hairless dogs are mated to...
-
Compute with the following order, first compute in terms of (dy) and then compute in terms of dx. please include all the steps of your calculation. 0 1 y exy dy dy dx. )
-
Which of the followingcarbocations is the least stable? CH3CH2 . CH3CHCH3 CH3 I . CH3C0 T CH3 IV. V. CH3 CH3CCH2 CH3
-
A specialist in the Human Resources department of a national hotel chain is looking for ways to improve retention among hotel staff. The problem is particularly acute among those who maintain rooms,...
-
True or False? A census offers the most accurate accounting of the characteristics of the target population.
-
A construction company manages two large building projects. Both require about 50 employees with comparable skills. At a meeting, the site managers from the two projects got together to estimate the...
-
A running mountain lion can make a leap 10.0 m long, reaching a maximum height of 3.0 m. a. What is the speed of the mountain lion just as it leaves the ground? b. At what angle does it leave the...
-
Emily throws a soccer ball out of her dorm window to Allison, who is waiting below to catch it. If Emily throws the ball at an angle of 30 below horizontal with a speed of 12 m/s, how far from the...
-
A soccer player takes a free kick from a spot that is 20 m from the goal. The ball leaves his foot at an angle of 32, and it eventually hits the crossbar of the goal, which is 2.4 m from the ground....
Study smarter with the SolutionInn App