Question: Need help with extracting the exons, the joined exons should come out as shown FASTA files to record the DNA sequences (NBPF1.fasta) >hg38_knownGene uc001ayw.5 range-chr1:16563943-16592021

Need help with extracting the exons, the joined exons should come out as shown

Need help with extracting the exons, the joined exons should come out as shown FASTA files to record the DNA sequences (NBPF1.fasta) >hg38_knownGene uc001ayw.5

FASTA files to record the DNA sequences (NBPF1.fasta) >hg38_knownGene uc001ayw.5 range-chr1:16563943-16592021 5'pad 0 3'pad 0 strands. repeatMasking-none ATGGTGGTATCAGCTGGCCCTTGGTCCAGCGAGAAGGCAGAGACGAACAT TTTAGAAATCAACGAGAAATTGCGCCCCCAGCTGGCAGAGAACAAACAGC AGTTCAGAAACCTCAAAGAGAAATGTTTTGTAACTCAACTGGCCGGCTTC CTGGCCAACCGACAGAAGAAATACAgtaagatctataggctcaccatcat gaaagtgatgaatgatgtcctgtcttctctctgagacactaaatgctctc tccatcaaaaataatttcatccttcctgtacttctaggaaaacagaaatg ggtattttaacattttgttaaagttggaagacagaggtaccaaagtattt agcaactttccatgtttgcaatcaggtgggggtgggactagagttaaact Read FASTA files In [3]: dna_file open("NBPF1.fasta") my-dna = dna-file. read() print (my_dna[0:10]) >hg38_know Exercise Extract multiple exons from the fasta file (NBPF1.fasta) Exon1: Exon2: Exon3: Join all the exons into a single sequences In [4]: joined_exons".join(c for c in my_dna if c.isupper()) print (joined_exons [1:300]) TGGTGGTATCAGCTGGCCCTTGGTCCAGCGAGAAGGCAGAGACGAACATTTTAGAAATCAACGAGAAATTGCG CCCCCAGCTGGCAGAGAACAAACAGCAGTTCAGAAACCTCAAAGAGAAATGTTTTGTAACTCAACTGGCCGGC TTCCTGGCCAACCGACAGAAGAAATACAAGTATGAAGAGTGTAAAGACCTCATAAAATTTATGCTGAGGAATG AGCGACAGTTCAAGGAGGAGAAGCTTGCAGAGCAGCTCAAGCAAGCTGAGGAGCTCAGGCAATATAAAGTCCT GGTTCAG FASTA files to record the DNA sequences (NBPF1.fasta) >hg38_knownGene uc001ayw.5 range-chr1:16563943-16592021 5'pad 0 3'pad 0 strands. repeatMasking-none ATGGTGGTATCAGCTGGCCCTTGGTCCAGCGAGAAGGCAGAGACGAACAT TTTAGAAATCAACGAGAAATTGCGCCCCCAGCTGGCAGAGAACAAACAGC AGTTCAGAAACCTCAAAGAGAAATGTTTTGTAACTCAACTGGCCGGCTTC CTGGCCAACCGACAGAAGAAATACAgtaagatctataggctcaccatcat gaaagtgatgaatgatgtcctgtcttctctctgagacactaaatgctctc tccatcaaaaataatttcatccttcctgtacttctaggaaaacagaaatg ggtattttaacattttgttaaagttggaagacagaggtaccaaagtattt agcaactttccatgtttgcaatcaggtgggggtgggactagagttaaact Read FASTA files In [3]: dna_file open("NBPF1.fasta") my-dna = dna-file. read() print (my_dna[0:10]) >hg38_know Exercise Extract multiple exons from the fasta file (NBPF1.fasta) Exon1: Exon2: Exon3: Join all the exons into a single sequences In [4]: joined_exons".join(c for c in my_dna if c.isupper()) print (joined_exons [1:300]) TGGTGGTATCAGCTGGCCCTTGGTCCAGCGAGAAGGCAGAGACGAACATTTTAGAAATCAACGAGAAATTGCG CCCCCAGCTGGCAGAGAACAAACAGCAGTTCAGAAACCTCAAAGAGAAATGTTTTGTAACTCAACTGGCCGGC TTCCTGGCCAACCGACAGAAGAAATACAAGTATGAAGAGTGTAAAGACCTCATAAAATTTATGCTGAGGAATG AGCGACAGTTCAAGGAGGAGAAGCTTGCAGAGCAGCTCAAGCAAGCTGAGGAGCTCAGGCAATATAAAGTCCT GGTTCAG

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Coca - Cola Enterprises (CCE) Case Study: Data analytics journey The HR analytics journey within CocaCola Enterprises (CCE) really began in 2010. Given the complexity of the CCE operation, its global...

Type or pasteCoca - Cola Enterprises (CCE) Case Study: The Thirst for HR Analytics Grows. "It's a great opportunity for HR, and we should not pass up on it, because, if executed well, HR analytics...

Need help with extracting company and college name info from below HTML source. Currently its printing null c= sel.xpath('//*[starts-with(@class,"inline-show-more-text")]/text()') print(c) company =...

need help with extracting data from file and storing them into "new" arrays. this is the data.txt file as an example: [1, 1]-3-Hello [1, 2]-3-Hello [1, 3]-3-Hello [2, 1]-3-Hello [2, 2]-3-Hello [2,...

Implement Fibonacci Min-Heaps in your favorite language. Your program should take in a list of n integers. For every function of the Fibonacci min-heap (insert, extract-min, decrease- key"), print...

Help on creating a procedure in sql, this file will be used to compile. Then afterwards I have to make another sql file to run and output the results. But for this part I'm stuck on the procedure...

Use the equation of the calibration line to calculate the concentration of the metal in the soil solution. Show labeled calculation. -- I need help to calculate the concentration Below is the data I...

please show steps. Thanks . Implement Fibonacci Min-Heaps in your favorite language. Your program should take in a list of n integers. For every function of the Fibonacci min-heap (insert,...

steps and explanation needed. Thanks in advance Implement Fibonacci Min-Heaps in your favorite language. Your program should take in a list of n integers. For every function of the Fibonacci min-heap...

Implement Fibonacci Min-Heaps in your favorite language. Your program should take in a list of n integers. For every function of the Fibonacci min-heap (insert, extract-min, decrease- key*), print...

Carpenter Company has the following balance sheet on December 31, 2015: The investment in Hinckley Company account reflects the original cost of an 80% interest (40,000 shares) purchased on January...

The future value of money is not the same as today dollars. And the same is true about money from the past. This phenomenon is known as the time value of money (TVM). Using the TVM concept, calculate...

When entering the Mensa's mortgage liability in Naviplan, why is it important to link it to the principal residence? The mortgage must be repaid if the house is sold. To qualify for a car loan. To...

Which of the following are problems with identifying users of ABC? Multiple select question. ABC means different things to different organizations. Organizations will announce the discontinuance of...

10-14 In MyMISLab, you will find a Collaboration and Teamwork Project dealing with the concepts in this chapter. You will be able to use Google Drive, Google Docs, Google Sites, Google+, or other...

10-7 How does the Internet change consumer and supplier relationships?

10-10 Columbiana is a small, independent island in the Caribbean that has many historical buildings, forts, and other sites, along with rain forests and striking mountains. A few first-class hotels...