Question: Olson Corp. reported the following in the Current Assets section of its December 31, 2017, balance sheet: 12/31/17 12/31/16 Accounts receivable, net of allowances of

Olson Corp. reported the following in the Current Assets section of its December 31, 2017, balance sheet: 12/31/17 12/31/16 Accounts receivable, net of allowances of $4,910 and $2,820, respectively 12/31/17- $54,040 12/31/16- $46,590

During 2017, Olson recorded $80,680 of sales on credit and wrote off $3,980 of uncollectible accounts.

1. Determine the amount of cash collected during 2017 from sales on credit. $ fill in the blank .

2. Determine the amount of bad debts expense for 2017. $ fill in the blank.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Accounting Questions!

Olson Corp. reported the following in the Current Assets section of its December 31, 2012, balance sheet: 12/31/12 12/31/11 Accounts receivable, net of allowances of $5,000 and $3,000, respectively...

Olson Corp. reported the following in the Current Assets section of its December 31, 2012, balance sheet: 12/31/12 12/31/11 Accounts receivable, net of allowances of $5,000 & $3,000,...

Olson Corp. reported the following in the Current Assets section of its December 31, 2017, balance sheet: _____________________________________ 12/31/17 _______________ 12/31/16 Accounts receivable,...

Working Backward: Allowance for Doubtful Accounts Olson Corp. reported the following in the Current Assets section of its December 31, 2016, balance sheet: 12/31/16 12/31/15 Accounts receivable, net...

olson corp. reported the following in the current assets section of its december 31, 2012 balance sheet: 12/31/12 12/31/11 accounts receivable,net allowances of 5,000 and 3,000 54,000 48,000...

Working Backward: Allowance for Doubtful Accounts Olson Corp. reported the following in the Current Assets section of its December 31, 2014, balance sheet: Accounts receivable, 12/31/14: $54,140,...

excercise 7-1,7-2,7-4 ear i pess income is $LS, 00 excrusive fo an Prcsident a the Compan has asked you to calculatc net incon altmatives of acccunning for bad dcbis Ine Direct wnte off methodl and...

Olson Corp. reported the following in the Current Assets section of its December 31, 2016 balance sheet: During 2016, Olson recorded $80,000 of sales on credit and wrote off $4,000 of uncollectible...

(4) Performance-Based Share Option Compensation Plan On January 1, 2016, Pierce Company establishes a performance-based share option plan for its 80 top executives. The terms of the plan are that...

Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG

Look again at the histograms of test scores for the three Statistics classes in Exercise 57. a) Overall, which class do you think performed better on the test? Why? b) How would you describe the...

Dandy Manufacturing Company uses two different independent variables ( machine - hours and number of packages ) in two different equations to evaluate costs of the packaging department. The most...

Hoover Zoo works with TV and movie producers who need birds that can perform special tricks, such as playing dead, reciting poetry, climbing ladders, and various other tricks. Hoover Zoo has about 4...