Question: Please help with Rstudio in using basic statistics about this DNA sequence and answering these questions with the txt file: >bioinformatics_is_awesome gcctgataagcgtgaggtcggaggttcaagtcctcctcgacccaccaaaattttggggcgttagctcagctgggagagcacctgctttgcaagcagggggtcatcggttcgatcccgatacgctccaccacttcttttgcgcagcaaaagaagcgcgggtggcagtgatttgcgcagcaaatcatgagaacccgct Please go through

Please help with Rstudio in using basic statistics about this DNA sequence and answering these questions with the txt file:

>bioinformatics_is_awesome gcctgataagcgtgaggtcggaggttcaagtcctcctcgacccaccaaaattttggggcgttagctcagctgggagagcacctgctttgcaagcagggggtcatcggttcgatcccgatacgctccaccacttcttttgcgcagcaaaagaagcgcgggtggcagtgatttgcgcagcaaatcatgagaacccgct

Please go through each step so I can understand.

A. What is the name of the sequence?

B. Length of sequence

C. Number of each nucleotide (i.e. how many As, Ts, Cs, and Gs?)

D. GC content (%)

E. GC content (%) for the 1st 100 bases

F. GC content (%) for the last 200 bases

G. Plot a bar graph showing the total of each nucleotide in the sequence. Make the bar for As- red, Ts- blue, Cs- green, and Gs- black. Don't forget to add axes and title.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

1-Please provide 5 cross-examination questions for: Chris Moss Dr. Gerry Stein Sydney Payne Terry Preece Leslie Brown Alex Lloyd 2-Explain why/how/if you would use exhibits A, B, C, and D. 3-What...

Source \documentclass[11pt]{article} \usepackage[margin=1in]{geometry} \usepackage{natbib} \usepackage{mathpazo} \bibpunct{(}{)}{;}{a}{,}{,} \usepackage{chngpage} \usepackage{stmaryrd}...

MNG3702/101/3/2016 Tutorial Letter 101/3/2016 Strategy Implementation and Control MNG3702 Semesters 1 and 2 Department of Business Management PLEASE NOTE: This tutorial letter contains important...

Table of Contents Main Objective of the assessment 1 Description of the Assessment 1 Learning Outcomes and Marking Criteria. 4 Format of the Assessment 6 Submission Instructions. 7 Avoiding...

Im having trouble with question 3 part A of the attached file. I know and understand her needs but im not sure if im filling out the table correctly ? Assignment Tier 1 Financial Planning...

Prepare a Statement of Advice (SOA) for the Martins interviewed for Assignment 1. The case study information is attached as a picture at the bottom of the page. As this assignment is to be a SOA for...

i need help from section 3 part A I have already posted this and you asked me to post under advanced option Assignment Tier 1 Financial Planning (Tier1FPPA_AS_v1A3) Page 2 of 92 Student...

Only need the excel section completed. I will do the written report stuff. Model is the format I want it complete in. Thanks Date 6/1/2010 7/1/2010 8/1/2010 9/1/2010 10/1/2010 11/1/2010 12/1/2010...

Please scan the SEC Plain English that I've attached. Please visit to this link.http://www.sec.gov/Archives/edgar/data/320193/000119312513416534/d590790d10k.htm#toc590790_9 Please read pages 25...

Assume the same facts as in Problem 32, except that the group members have adopted the relative tax liability tax-sharing method. In Problem The Chief consolidated group reports the following results...

A $148,800 mortgage for 15 years for a new home is obtained at the rate of 5.4% compounded monthly. Find (a) the monthly payment, (b) the interest in the first payment, (c) the principal repaid in...

Substantial use of debt will magnify Blank _ _ _ _ _ _ as volume or operating income increases.Multiple choice question.EBITsalesgross profitsEPS

On 1 March 2007 DB Limited issued R560 000 15% debentures at R98. The debentures were to be redeemed at par in four equal annual payments starting 28 February 2010. Required: Journalise the above...