Question: please I want the answer with good explanation .. The current price dollar 90, the expected dividend next year dollar 6 per share, expected price

please I want the answer with good explanation .. The current

please I want the answer with good explanation ..

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 57, the opportunity cost 0.1. What is the value of share? Answer: Question 2 Not yet answered Marked out of 2.00 P Flag question Consider a company whose stock is trading at $110 per share. This company requires an 0.1 minimum rate of return and will pay a 10 dividend per share last year, which is expected to increase by 0.1 annually. What is the price for this company

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Finance Questions!

For each control, identify the assertion for which the control is designed to prevent, or detect. and correct misstatements. a. Occurrence of sales. f. Cutoff of sales. b. Rights and obligations for...

From the following information of two companies. Company Xy P/E ratio is 12. Company P/E is 7. The sum total of the post tax earnings of the above mentioned companies are dollar 1692689. Assume the...

1)The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 54, the opportunity cost 0.1. What is the value of share? 2)Consider a...

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 49, the opportunity cost 0.1. What is the value of share? Answer:...

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 49, the opportunity cost 0.1. What is the value of share? Answer:

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 79, the opportunity cost 0.1. What is the value of share? Answer: Lamis

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 46, the opportunity cost 0.1. What is the value of share

The current price dollar 90, the expected dividend next year dollar 5 per share, expected price of share after two year dollar 67, the opportunity cost 0.1. What is the value of share

The current price dollar 90, the expected dividend next year dollar 2 per share, expected price of share after two year dollar 53, the opportunity cost 0.1. What is the value of share

The current price dollar 90, the expected dividend next year dollar 6 per share, expected price of share after two year dollar 57, the opportunity cost 0.1. What is the value of share?

The current price dollar 90, the expected dividend next year dollar 5 per share, expected price of share after two year dollar 49, the opportunity cost 0.1. What is the value of share

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Graph the following sets of production possibilities and explain why the law of increasing costs is violated. BUSHELS OF ORANGES BUSHELS OF GRAPEFRUIT 200 150 100 50 SET 19 40 80 130

Chapter 20 Questions 1 & 3 1. We said that options can be used either to scale up or reduce overall portfolio risk. What are some examples of risk-increasing and risk-reducing options strategies?...

Add "Viggo Mortenslet cast = new Map ( ) ;en " to the cast as the key, with value "Aragorn".