Question: An AASHTO I-section Type II beam is used in designing a prestressed concrete girder, if you know that f=45MPA, f'=35MPa, f,=1.48MPA, fs=3.35MPA, f=(-18)MPa, f=(-20.25)MPa,

An AASHTO I-section Type II beam is used in designing a prestressed

An AASHTO I-section Type II beam is used in designing a prestressed concrete girder, if you know that f=45MPA, f'=35MPa, f,=1.48MPA, fs=3.35MPA, f=(-18)MPa, f=(-20.25)MPa, f=1860MPA, M,=150KN.m, MeD=100KN.ml, M, =350kN.m, losses 15% and 0.5"-7wires strand of constant eccentricity is C ci CS used. Detremine the value of Pi in (kN) Select one: a. 2176 O b. 2435 . 2564 O d. 2305

Step by Step Solution

★★★★★

3.46 Rating (156 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

Give... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Civil Engineering Questions!

If you know that the rate of Iraq's oil reserves is 148 billion barrels, and that the average OPEC reserve is 1080 billion barrels, and Iraq's oil production is 4 million barrels per day, OPEC...

if you know that the pipe workshop is used daily for 6 hours .where it consumes during the first 4 hours a current of 30A ,and in the last two hours it consumes a current 10A .calculate the...

If you know that a distribution of scores is bimodal, or asymmetric, or a J-curve, or any other shape that departs significantly from the normal distribution, would it be correct to use Table A to...

Compute the value of the correlation coefficient, state hypothesis, test the significant of the correlation coeffieicnt, and give a brief explanation of the type of relationship At Bats and Hits The...

"At what instant of time are the velocity and acceleration in the same direction? At what instant of time is acceleration zero? At what instant of time does the particle slow down? " 25 t = 2 s 20 1=...

Two different companies have applied to provide cable television service in a certain region. Let p denote the proportion of all potential subscribers who favor the first company over the second....

16. Product Design. Burnside Marketing Research conducted a study for Barker Foods on several formulations for a new dry cereal. Three attributes were found to be most influential in determining...

Use the data "fl_student_survey" to complete the following analysis. a) Using the variable "political_affiliation": i) Obtain a bar plot. ii) State the modal category. b) Using the variables "gender"...

Debra wants to know if her sister can be her qualifying child.Which of the following is not a test to be a Qualifying Child? Select one: a. The child must be under age 19 at the end of the year or...

If interest rates rise after a bond issue, what will happen to the bonds price and YTM? Does the time to maturity affect the extent to which interest rate changes affect the bonds price? (Again, an...

An investor is trying to decide between two promising technology stocks to round out his portfolio. The remainder of his portfolio consists of relatively conservative companies and will not enter...

Question 8 1 pts Statistics has a long and rich history, yet only rather recently has it been recognized as an important element of business, driven to a large extent by the massive growth of data in...

Calculate the following quantity: final volume of a 0.0154 M solution prepared by diluting 17.6 mL of 0.168 M lithium carbonate with water.

Calculate the following quantity: molarity of a solution prepared by diluting 43.33 mL of 0.0253 M ammonium sulfate to 475.00 mL.

The objective of this assignment is to develop a script and define a method of communication for obtaining a local business sponsor for your Senior Capstone Project. The script will represent the...

From a marginal analysis perspective, what is the inventory carry cost for Andrews if the company carries one additional unit of Ant in inventory at the end? A) $3.17 B) $13.57 C) $6.34 D) $1.63

Superbyte Corporation sells photographic equipment. Superbyte leases equipment to Laguna Madre Company on January 1 of the current year. The cost to manufacture the equipment was $12,000,000. The...

how do I make this molecule (5'- GACTCGTACAGTAGCTTAGC -3') double stranded while also showing the number of bonds between each base pair

GIVEN: An AASHTO Type II precast prestressed pretensioned girder will be used to carry a 6 inch cast-in-place slab to form a composite beam that will span 65 feet between simple supports. The girder...

Using van-mounted state of-the-art video technology, the Mississippi Department of Transportation collected data on the number of cracks (called crack intensity) in an undivided two-lane highway....

A 1 8 m long AASHTO Type II beam, simply supported, has a cross sectional area of 3 5 0 , 0 0 0 m m 2 , a moment of inertia of 4 . 9 0 1 0 1 0 m m 4 , a weight of 9 . 0 K N m , a distance from the...

Four soil samples are described in the table below. 1- Classify these soils according to the AASHTO Classification System. II. Classify these soils according to the United Soil Classification System....

The Bolded words are the questions asked!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Question 1) The Sea Wharf Restaurant would like to determine the best way to allocate a monthly...

Round Tree Manor is a hotel that provides two types of rooms with three rental classes: Super Saver, Deluxe, and Business. The profit per night for each type of room and rental class is as follows:...