Please write a python code to solve the code challenge. Please use the sample input and output. please show me the code you use on a python sheet, so I can make sure my indents are right.

Code Challenge: Implement Gibbs Sampler Input: Integers k. t, and N, followed by a collection of strings Dna Output: The strings BestMotifs resulting from running Gibbs Sampler Dna, kt.) with 20 random starts. Remember to use pseudocounts! Note: The next lesson features a detailed example of Gibbs Sampler, so you may wish to return to this problem later. Extra Dataset Debug Datasets Sample Input: 8 5 100 CGCCCCTCTCGGGGGTGTTCAGTAACCGGCCA GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG TAGTACCGAGACCGAAGAAGTATACAGGCGT TAGATCAAGTTTCAGGTGCACGTCGGTGAACC AATCCACCAGCTCCACGTGCAATGTTGGCCTA Sample Output: TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG