Please write a python code to solve the code challenge. Please use the sample input and output.

We now redefine the Frequent Words Problem to account for both mismatches and reverse complements Recall that Patternrefers to the everse complement of Pattern Frequent Words with Mismatches and Reverse Complements Problem: Find the most frequent k mers (with mismatches and reverse complements) in a string Input A DNA string Text as well as integers k and d Output All k-mers Pattern maximizing the sum Count.Text. Pattern)+ Count.Text. Patterne) over all possible k-mers. Gode Challenge: Solve the Frequent Words with Mismatches and Reverse Complements Problem, . Bare Daianet Delu-Duacens Sample Input: ACGTTGCATGTCGCATGATGCATGAGACCT 4 Sample Output: ATOT ACAT