Question: Please write a python code to solve the code challenge. Please use the sample input and output. Please show me the code you use on
Please write a python code to solve the code challenge. Please use the sample input and output. Please show me the code you use on a python sheet, so I can know how to put it in python.
Code Challenge: Implement RandomizedMotifSearch Input: Integers k and followed by a collection of strings Dna Output: A collection BestMotifs resulting from running RandomizedMotif Search(Ona, k. 1) 1,000 times. Remember toisenseudocounts Extra Dataset Debug Datasets Sample Input: 8 5 CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG TAGTACCGAGACCGAAAGAAGTATACAGGCGT TAGATCAAGTTTCAGGTGCACGTCGGTGAACC AATCCACCAGCTCCACGTGCAATGTTGGCCTA Sample Output: TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG 2012 BR Code Challenge: Implement RandomizedMotifSearch Input: Integers k and followed by a collection of strings Dna Output: A collection BestMotifs resulting from running RandomizedMotif Search(Ona, k. 1) 1,000 times. Remember toisenseudocounts Extra Dataset Debug Datasets Sample Input: 8 5 CGCCCCTCTCGGGGGTGTTCAGTAAACGGCCA GGGCGAGGTATGTGTAAGTGCCAAGGTGCCAG TAGTACCGAGACCGAAAGAAGTATACAGGCGT TAGATCAAGTTTCAGGTGCACGTCGGTGAACC AATCCACCAGCTCCACGTGCAATGTTGGCCTA Sample Output: TCTCGGGG CCAAGGTG TACAGGCG TTCAGGTG TCCACGTG 2012 BR
Step by Step Solution
There are 3 Steps involved in it
Get step-by-step solutions from verified subject matter experts
