Question: Please write in Python 3 You are to design a program that works as follows. It should ask the user for an original DNA string

Please write in Python 3 Please write in Python 3 You are to design a program

You are to design a program that works as follows. It should ask the user for an original DNA string as well as the particular pattern that is inverted. It should then locate the leftmost occurrence of that pattern, and the next subsequent and disjoint occurrence of the inverted pattern. The output should be the mutated DNA, with the segment including the inverted pair reversed. An example session might proceed as follows (where the user input is shown in bold): Enter a DNA sequence: CGATTGAACATGTAAGTCCATT Enter the pattern: TGAA Mutated DNA sequence: CGATTGAATGTACAAGTCCAAT.T

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Please write in Python 3. DNA can be modeled as a string of characters using the alphabet A, C, G, and T. One form of DNA mutation occurs when a substring of the DNA is reversed during the...

Your program is responsible for performing only the single mutation that occurs between the first occurrence of the pattern, and the next subsequent occurrence of the reversed pattern (that which is...

1. Please write a Python 3 Program. Please show all of the outputs. hint to query the user for info at the command line, you use: response = input("a prompt for the user > ") response will be a...

1411116 - Programming I Assignment #3 Due Date: November 30, 2016 Submission Instructions: Submit your assignment on the blackboard link, corresponding to your Section: Please follow the following...

1.(30 marks) A string in CH is simply an array of characters with the null character(\0) used to mark the end of the string. CH provides a set of string handling function in as well as I/O functions...

PLEASE HELP IN PYTHON 3 Write a program that asks the user for a positive integer between 0 and 1 billion, exclusive, then prints the number as a text string. For example, the number 2020 will be...

Please help in PYTHON 3 Write a program that asks the user for a positive integer between 0 and 1 billion, exclusive, then prints the number as a text string. For example, the number 2020 will be...

beginner python Assignment 5 (void returning Functions with parameters) Question 1: (15 points) Write a function that takes no parameters as input and inside the function should ask the user to input...

1.(30 marks) A string in C++ is simply an array of characters with the null character(\0) used to mark the end of the string. C++ provides a set of string handling function in as well as I/O...

Challenge: Calculate the Volume of a Cylinder Description: Write a Python 3 program called cylindervolumecalc.py that accepts user input from the keyboard for the radius and height of the cylinder...

Choose the allowed instruction addressing modes (select more choices * Mov [SI],SI Mov 23H,AL Mov Ax,23H Mov IP,AX Mov Ax,SI Mov CS,SI Mov ES,DS

Java_02: Write a program that will print the figure below. ********** ********** ********** ********** ********** ********** **********

1 . Dog Up ! Franks is looking at a new sausage system with an installed cost of $ 5 8 0 , 0 0 0 . This cost will be depreciated straight - line to zero over the project s five - year life, at the...

You are considering a project that will pay $712 in the first year, $2,184 in the second year, and $3,362 in the third year. In the fourth year, the project will pay a cash flow of 3,000, which...

1. Identify three approaches to culture.

f. What was your neighborhood like? Discuss your answers with classmates. Analyze how your own cultural position is unique and how it is similar to that of others.

2. Define communication.