Question: Problem 1: Michael Jackson's dead body was found at around 6:24 PM in a hotel room where the temperature is maintained at 18C. At

Problem 1: Michael Jackson's dead body was found at around 6:24 PM

Problem 1: Michael Jackson's dead body was found at around 6:24 PM in a hotel room where the temperature is maintained at 18C. At that time, its temperature was found out to be 30.5C and dropped to 29.75C half an hour later. Assuming that his body temperature was normal (37C) the moment he died, estimate Michael Jackson's time of death using Newton's law of cooling. Express your answer in HH:MM format rounded off to the nearest 1/12 of an hour. Express final answer as a one-line implicit function.

Step by Step Solution

★★★★★

3.42 Rating (155 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!

A minibar in a hotel room generally provides an impression that the hotel experience is more upscale. PKF Hospitality research reported that mini bars provide a mean annual revenue of $368 per hotel...

A woman has been outdoors where the temperature is 10C. She walks into a 25C house, and her glasses steam up. Using the vapor pressure curve for water that accompanies Problem find the smallest...

A minibar in a hotel room generally provides an impression that the hotel is more upscale. PKF Hospitality research reported that minibars provide a mean annual revenue of $368 per hotel room (USA...

High-altitude mountain climbers do not eat snow, but always melt it first with a stove. To see why, calculate the energy absorbed from your body if you: (a) Eat 1.0 kg of -15 C snow which your body...

The turnover of legislators is a problem of interest to political scientists. It was found that one model of legislative turnover in a particular body was M(t) = 434e -0.08t , where M(t) represents...

The manufacturer of a heat flux gage like that illustrated in Problem 1 12 claims the time constant for a 63.2% response to be = (4d 2 pc p ) 2 k where p, c p, and k are the thermo physical...

Below are normal probability plots of the HBE data from Exercise 7.10.8. (a) Using the plots to support your answer, is there evidence of abnormality in either of the samples? (b) Considering your...

10.31 Temperature and academic performance. Does temperature affect academic performance? If yes, does the relationship vary by sex? To study these questions, researchers from Berlin, Germany,...

To study the function of a gene in detail, you downloaded a piece of genomic sequence for this gene from the NCBI database. 5 - ATGAACACTTCGGAAGGTTGTATCGGTGGTCGATTC - 3 a. (10 pts) Write down the...

On January 1, 2011, the Allegheny Corporation purchased machinery for $115,000. The estimated service life of the machinery is 10 years and the estimated residual value is $5,000. The machine is...

Before the law was changed about 15 years ago, banks arranged financial transactions that allowed companies to keep a portion of their liabilities off their books. The deals were structured to make...

The following were selected from among the transactions completed during the current year by Bonita Co., an appliance wholesale company: Jan. 20. Sold merchandise on account to Wilding Co., $30,750....

Assets include financial assets and long term capital assets All capital assets are paid from a capital projects fundPayments on debt are accounted for in cpf Cpf accounts for resources that are...

List functional characteristics necessary to maintain life in humans

(a) What is horizontal communication? (6 marks) (b) How is the horizontal form of communication more prominent in Intermountain Healthcare? (4 marks)

Electric field component of EM wave propagated in a homogeneous environment, It is given as. According to this; the frequency of the wave, phase constant, velocity, relative permeability of the...

A public good is defined to be non-exclusive and non-rival. A good is not be excluded from consuming it. Also, a good is additional consumer has a marginal cost of zero. One of the problems related...

5:52 PM Mon Oct 27 . . . all 75%

Show that a system of differential equations that describes the currents i 2 (t) and i 3 (t) in the electrical network shown in the following figure is L di 2 /dt + L di 3 /dt + R 1 i 2 = E(t) -R 1...

Find a function whose square plus the square of its derivative is 1.

In problem find the general solution of the given second-order differential equation. y'' + 9y = 0

Given the following information: Expected demand during a lead time = 300 units Standard deviation of demand during a lead time= 30 units Demand during a lead time is distributed Normally: a....

A manager just received a new price list for boxes from a supplier. It will now cost $ 1.00 a box for order quantities of SOI or more, $1.10 a box for 200 to 800, and $1.20 a box for smaller...

A jewellery manufacturer buys semi-precious stones to make bracelets and rings. The supplier has quoted a price of $8 per stone for order quantities of 600 stones or more, $9 per stone for orders of...