Python in VS Code:

import os

def dna$\_$to$\_$rna$($sequence$)$:

$"""$Convert a DNA sequence to its corresponding RNA sequence."""

return sequence.replace$(\text{'}$T$\text{'},\text{'}$U$\text{'})$

def parse$\_$file$\_$into$\_$acids$($filename$)$:

$"""$Read a codon data file and return its contents as a $2$D list."""

try:

with open$($filename$,\text{'}$r$\text{'})$ as file:

lines $=$ file.readlines$()$

return $[$line$.$strip$().$split$()$ for line in lines$]$

except FileNotFoundError:

print$($f$"$Error: The file $\{$filename$\}$ was not found."$)$

exit$(1)$

def translate$\_$rna$\_$to$\_$protein$($rna$\_$sequence, codon$\_$dict$)$:

$"""$Translate RNA sequence to a protein sequence using the provided codon dictionary."""

protein$\_$sequence $=[]$

start$\_$codon$\_$index $=$ rna$\_$sequence.find$("$AUG$")$

if start$\_$codon$\_$index $==-1$:

return $""$ # No start codon found

# Start from the start codon

rna$\_$sequence $=$ rna$\_$sequence$[$start$\_$codon$\_$index:$]$

for i in range$(0,$ len$($rna$\_$sequence$)-2,3)$: # Ensure we don't go out of bounds

codon $=$ rna$\_$sequence$[$i:i$+3]$

if codon in $["$UAA$",$ "UGA", "UAG"$]$:

break # Stop codon encountered

if len$($codon$)==3$ and codon in codon$\_$dict:

protein$\_$sequence.append$($codon$\_$dict$[$codon$])$ # Append the one$-$letter code

return $\text{'}\text{'}.$join$($protein$\_$sequence$)$ # Join and return as a single string

def main$()$:

# Take absolute input filenames

codons$\_$filename $=$ input$("$Enter the absolute path for CODONS$\_$FILENAME: $")$

sequences$\_$filename $=$ input$("$Enter the absolute path for SEQUENCES$\_$FILENAME: $")$

output$\_$filename $=$ input$("$Enter the absolute path for OUTPUT$\_$FILENAME: $")$

# Parse the codon table

codon$\_$table $=$ parse$\_$file$\_$into$\_$acids$($codons$\_$filename$)$

# Prepare a dictionary for fast codon lookup

codon$\_$dict $=\{$entry$[0]$: entry$[2]$ for entry in codon$\_$table$\}$

# Process each DNA sequence

try:

with open$($sequences$\_$filename, $\text{'}$r$\text{'})$ as seq$\_$file, open$($output$\_$filename, $\text{'}$w$\text{'})$ as out$\_$file:

for dna$\_$sequence in seq$\_$file:

dna$\_$sequence $=$ dna$\_$sequence.strip$()$ # Remove whitespace$/$newline characters

rna$\_$sequence $=$ dna$\_$to$\_$rna$($dna$\_$sequence$)$ # Convert to RNA

protein$\_$sequence $=$ translate$\_$rna$\_$to$\_$protein$($rna$\_$sequence, codon$\_$dict$)$ # Translate RNA to protein

out$\_$file.write$($f$"\{$dna$\_$sequence$\}\{$protein$\_$sequence$\}$

$")$ # Write to output file

except FileNotFoundError:

print$($f$"$Error: The file $\{$sequences$\_$filename$\}$ or $\{$output$\_$filename$\}$ was not found."$)$

exit$(1)$

if $\_\_$name$\_\_=="\_\_$main$\_\_"$:

main$()$

Errors:

$[$ RUN $]`$dna$\_$to$\_$rna$`-$ Example Execution $($test$\_$public.RNATranslationPublicTests.test$\_$dna$\_$to$\_$rna$\_$example$\_$execution$)$

$[$ FAIL $]`$dna$\_$to$\_$rna$`-$ Example Execution

Failure reason:

Incorrect output.

Expected output: GGCCCGGGCCGAUGGCUGGGUACUAAUUUGGGAUGAGUUU

Your output : CCGGGCCCGGCUACCGACCCAUGAUUAAACCCUACUCAAA

Every execution has wrong number of elements:

$[$ RUN $]$ Example Execution $1($test$\_$public.RNATranslationPublicTests.test$\_$example$\_$execution$\_1)$

$[$ FAIL $]$ Example Execution $1$

Failure reason:

Incorrect number of elements.

Expected number of elements: $3$

Your number of elements : $4$

$--------------------$

$--------------------$

$[$ RUN $]$ Example Execution $2($test$\_$public.RNATranslationPublicTests.test$\_$example$\_$execution$\_2)$

$[$ FAIL $]$ Example Execution $2$

Failure reason:

Incorrect number of elements.

Expected number of elements: $0$

Your number of elements : $1$