CODE IN PYTHON

def rna2codon (rna): This function takes in a string representing an RNA sequence, and returns the corresponding amino acid string, as transcribed by this codon table. You do not need to transcribe the stop codon. (HINT: You already did this in Labo3, go open it up and figure out how to incorporate it here!) Example: Sample RNA string: "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA" The returned protein string: "MAMAPRTEINSTRING" def locate_substring(dna_snippet, dna): This function takes in two strings, dna_snippet and dna, where dna_snippet is a substring of dna, and returns all locations of the substring as a list of integers. In other words, dna_snippet may exist in multiple locations within dna; you should return the beginning index position of each occurrence of dna_snippet inside of dna. Example: Sample DNA snippet (substring): "ATAT" Sample DNA string: "GATATATGCATATACTT" The returned position list: (1, 3, 9]