Q $9$ & $10$ Answer both

Q$9.$ In the PV$-92$ lab, we isolated DNA from cheek cells to determine if the retrotransposable element, Alu$-1,$ had been inserted at the PV$-92$ locus of chromosome $16.$ Alu$-1$ is a $300$ bp dimorphic insert that can either be present or absent$.$ It does not encode a protein product and has lost the ability to transpose.

Part A: After isolating your DNA, you set$-$up a PCR reaction by adding your DNA along with master mix into a PCR tube. What are the components in a master mix that make PCR possible? Afterwards, you left the tube with your instructor who placed it into the thermocycler and treated your tube to a series of conditions. What were the three steps $($or molecular events$)$ that were exposed to your tubes during the PCR reaction and what is the point of each step? $($One sentence minimum should be described per step.$)$

$\backslash$table$[[$Components of Master Mix $(4$pts$),$PCR Conditions $(3$pts$)],[,1.],[,2.]]$

Part B: In order to amplify your target sequence, you needed to have a forward and a reverse primer that could bind to PV$-92.$ Below is one strand of part of the sequence at PV$-92.$ The Alu$-$I element is highlighted in yellow and the underlined regions are the sequences in which your primers are meant to hybridize to amplify the target fragment.

PV$-92$ locus sequence:

$5\text{'}-$TATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCAT

TTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGC

AGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGAT

TATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTA

AGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGA

TATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTT

CCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTT

CTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAACAAA$-3\text{'}$

The forward and reverse primers used during the PCR reaction are as follows:

Forward: $5\text{'}-$ TTGGAACAGGAAGAGAATCA $-3\text{'}$

Reverse: $5\text{'}-$ AAAAAGTCTACTAATTTGGT $-3\text{'}$

Using the rules of primer design $($assuming that both primers have a melting temperature of $60C),$ please explain with two comments if the above primer pair would or would not be serve as good candidates for amplifying PV$-92?(3$pts$)$

Would these primers amplify your intended target at the PV$-92$ locus? Yes or No

Provide $2$ sentence on explaining your answer choice of why or why not using the primer design rules. Remember, both primers have a melting temp of $60$ degrees so think about the other rules to primer design.

$1.$

$2.$