Question: Question#5: Consider the pseudo code of binary search algorithm as follows: low=0; high=n-1; while (lowvalue high=mid-1; Now solve questions given below: a) Consider an array

Question#5: Consider the pseudo code of binary search algorithm as follows: low=0; high=n-1; while (lowvalue high=mid-1; Now solve questions given below: a) Consider an array [18,22,20,25,30,44,60,51, 37] and value=60. Dry run the code and show in which time complexity class does the algorithm fall. b) Update and show the values of low, mid and high through the iterations. c) What is the T(N) of above algorithm asymptotically? Use a notation of your choice

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Objectives This requires you to implement the Perceptron algorithm using the Python programming language. NOTE No credit will be given for implementing any other types of classification algorithms or...

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

using java Instructions: Write a program called RandomClassGrades.java that will create and fill a two dimensional array with integers 0-100 corresponding to grades in different classes. Each row...

MATHEMATICS FOR MACHINE LEARNING Marc Peter Deisenroth A. Aldo Faisal Cheng Soon Ong Contents Foreword 1 Part I Mathematical Foundations 9 1 Introduction and Motivation 11 1.1 Finding Words for...

Please help me make an Executive Summary. Explain what you will examine in the case study. Write an overview of the field you are researching. Make a thesis statement and sum up the results of your...

10 points Save Answer Consider the pseudo code of the motif search using greedy approach discussed in class (in Book it is in section 5.5). Let's say you are interested in a motif of length 4 and...

which of the 16 possible 2-mers has the highest value of totalDistance(v,DNA) from the DNA sequence ? cctgatagacgctatctggctatcc cc ac tt gc 10 points QUESTION 2 Instead of four bases, let's assume...

Consider two pseudo - code snippets illustrating file transfer mechanisms between a client and a server. Pseudo - code 1 :

Question 3 Consider the pseudo code of the motif search using median string finding approach. Let's say you are interested in a motif of length 5, each sequence in DNA is of length 100, and there are...

Jedren Corporation has 30,000 shares of $75 par value, 10%, preferred stock and 150,000 shares of $1 par value common stock outstanding at December 31, 2014. Instructions Answer the questions in each...

A variable is normally distributed with mean 10 and standard deviation 3. a. Determine and interpret the quartiles of the variable. b. Obtain and interpret the seventh decile. c. Find the value that...

The following are prices and consumption quantities for three commodities in 2007 and 2017:

Donald, Anne, and Todd have the following capital balances; $ 4 0 , 0 0 0 , $ 5 0 , 0 0 0 and $ 3 0 , 0 0 0 respectively. The partners share profits and losses 2 0 % , 4 0 % , and 4 0 % respectively....

KEY QUESTION A firm has fixed costs of $60 and variable costs as indicated in the table on the next page. Complete the table and check your calculations by referring to question 4 at the end of...

LAST WORD What is a sunk cost? Provide an example of a sunk cost other than one from this book. Why are such costs irrelevant in making decisions about future actions?

KEY QUESTION Use the concepts of economies and diseconomies of scale to explain the shape of a firms long-run ATC curve. What is the concept of minimum efficient scale? What bearing can the shape of...