The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer. The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer.
Expert Answer:
Answer rating: 100% (QA)
3 a The type of overhang generated from the above restriction enzymes will be of the staggered type ... View the full answer
Related Book For
Posted Date:
Students also viewed these biology questions
-
The figure below shows the production possibilities frontiers (PPFs) for Italy and India for their domestic production of olives and tea. Without trade, assume that each is consuming olives and tea...
-
The figure below shows the one-year return distribution for RCS stock. Calculate a. The expected return. b. The standard deviation of thereturn. 35 30 25 20 15F 2 10 -25% -10% 0% 10% 25% Return
-
The figure below shows a scheme for testing hydrocarbon compounds to determine whether they are saturated or unsaturated. Draw the scheme and complete it by filling in the missing words related to...
-
What are the concepts of traditional and contemporary organizational design? Will these designs be influenced differently by management and the environment?
-
Refer to the Journal of Forest Engineering (July 1999) study of minimizing tractor skidding distances along a new road in a European forest, Exercise 6.37. The skidding distances (in meters) were...
-
Laurel Inc. issues 10-year bonds with a maturity value of \(\$ 200,000\). If the bonds are issued at a premium, this indicates that: a. the contractual interest rate exceeds the market interest rate....
-
What future changes or revolutions can you envision happening as a result of ICTs such as social media and IT networks?(pp. 382385)
-
The Duncan Companys stock is currently selling for $15. People generally expect its price to rise to $18 by the end of next year. They also expect that it will pay a dividend of $.50 per share during...
-
In 2020, Flamengo Corporation had the following: Cash $32,000; Short-term investments $7,000; Accounts receivable $45,000; Supplies $6,000; Long-term notes receivable $1,500; Equipment $196,000;...
-
The Evanstonian is an upscale independent hotel that caters to both business and leisure travelers. When a guest calls room service at The Evanstonian, the room-service manager takes down the order....
-
How do different forms of government explain the necessity for government?
-
Watch the clip from HBO's Chernobyl and respond to the questions below using complete sentences....
-
1) Every organization has a unique culture. As you move forward with a travel or per diem position, what steps will you take to learn about your assignment organization's culture? 2)Flexibility and...
-
See the right figure of the lifting and transporting equipment. During operation, while a mass of 1.5 x 104 kg was descending at a constant speed v = 15 m/min, the machine experienced a breakdown,...
-
PROBLEM 3 BABEY Company makes three products with the following characteristics: Product V jk jin Selling price per unit 10 15 20 Variable cost per unit 6 10 10 Machine hours per unit 2 4 10 The...
-
Diversified Semiconductors sells perishable electronic components. Some must be shipped and stored in reusable protective containers. Customers pay a deposit for each container received. The deposit...
-
In the context of each of the four areas noted below, consider and analyse the financial and non-financial data that a potential investor would require in order to assess the future performance of a...
-
Wal-Mart is the second largest retailer in the world. The data file on the disk holds monthly data on Wal-Marts revenue, along with several possibly related economic variables. a) Using computer...
-
The Economist commented on the Greek debt crisis in an aptly titled article on February 11, 2012, Brinkmanship in Athens, as Greece led the European economy to the edge as a battle brewed between...
-
The following figure shows the supply and demand for strawberries. Answer the questions that follow. Supply and Demand of Strawberries a. Indicate the equilibrium price and equilibrium quantity. b....
-
How do sticky wages and prices make monetary policy effective in the short run?
-
What term describes information that is sent to recipients at their request via Web sites, bulletin boards, e-learning, knowledge repositories like blogs, and other means? a. push communications b....
-
A ________________ report is a reflective statement that documents important information learned from working on the project. a. final project b. lessons-learned c. project archive d. progress LO.1
-
A(n) ________________ report describes where a project stands at a specific point in time. a. status b. performance c. forecast d. earned value LO.1
Study smarter with the SolutionInn App