Question: The following DNA sequence contains a six base palindromic sequence that is a recognition and cutting site for a restriction enzyme. This DNA sequence is

The following DNA sequence contains a six base palindromic sequence that is a recognition and cutting site for a restriction enzyme. This DNA sequence is the same when read forward on the top strand of DNA and backward on the bottom strand of DNA. What is the six base palindromic sequence that is found in the DNA sequence below

CCGAGTAAGCGTAC

GGCTCATTCGCATG

Identify the restriction enzyme that cuts DNA at this palindromic site

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

We are given the same short DNA sequence of the previous problems: ACTGATCGATTACGTGAATTCATAGTATATCATACATATATATCGATGCGTTCAT The sequence contains a recognition site for the EcoRI restriction enzyme,...

The term 'endonuclease' refers to cutting the DNA sequence from ______________ a) only within the polynucleotide chain, not at the ends b) the ends of the chain c) anywhere in the chain d) exactly in...

the required functions are at the end for easy use. These are the functions required that I have coded. I am lost on how to contribute them into these new functions. Once the new functions are coded...

Question: Genomic sequence of gene of interest:...

Scenario: You are studying a new genetic disease involving dysregulated inflammation and blood coagulation. You have determined that the patients suffering from this disease all share a mutation in...

can someone please do this ASAP ? Thanks Homework #3 C++ programming assignment (100 points) Due March 12, 11:00pm This is an individual assignment Please follow the Blackboard instructions on...

c++ For this assignment you will receive as input two text files, rebase210.txt and sequences.txt. After the header, each line of the database file rebase210.txt contains the name of a restriction...

after the header, each line of the database file rebase210.txt contains the name of a restriction enzyme and possible DNA sites the enzyme may cut (cut location is indicated by a ) in the following...

After the header, each line of the database file rebase210.txt contains the name of a restriction enzyme and possible DNA sites the enzyme may cut (cut location is indicated by a ) in the following...

Part 2 Introduction to the problem For this assignment you will receive as input two text files, rebase210.txt and sequences.txt. After the header, each line of the database file rebase210.txt...

4. What is meant by a "yardstick method" of selecting a person to fill a managerial role? 5. In the film "Big Rocks First" by Steven Covey - shown when talking about activity avoidance, what was the...

Write a report assessing the basic environmental health principles, theories, and issues of an emerging or reemerging disease. Select Rift Valley Fever disease to research for this report. Analyzes...

John has started a business that is low growth, not scaleable but allows him to earn a comfortable salary. John's business is: A lifestyle business Not likely a candidate for venture capital...

. Provide a brief summary Provide APA in-text citations and APA reference from which information is sourced