Question: The following double stranded DNA sequence shows a gene encoding a small peptide. The three stop codons are UAA, UAG, and UGA. 5 ' ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG

The following double stranded DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA, UAG, and UGA.
5' ATGACGTATAATCACCGTAGATAACAGTAATTGATAAATCAG 3'
3' TACTGCATATTAGTGGCATCTATTGTCATTAACTATTTAGTC 5'
How many amino acids long will the small protein be that is encoded by this "gene"?

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

BME 201 HOMEWORK 5 - How to fix the code for DNA Replication, Transcription, and translation. InsulinDNAseq is included. Please help! 0 10f7 BME 201 Homework 5 - Molecular Biology: Transcription and...

Q:

1) The strands of double stranded DNA are arranged in ___________fashion and form a__________ A) parallel.......Beta Pleated Sheet B) Anti-Parallel........Beta Pleated Sheet C)...

Q:

. PCR is a DNA amplifying in vivo method. a) True b) False 2. Which of the following is a mismatch? a) Polymerase - Taq polymerase b) Template - double stranded DNA c) Primer - oligonucleotide d)...

Q:

Which of the following is TRUE of nucleic acids? A double stranded DNA molecule with 16% Guanine bases would have 34% Adenine bases When nucleotides are linked together with a phosphodiester bond,...

Q:

Ligation is defined as ______________ a) Alignment of only double stranded DNA molecules at the ends and the formation of phosphodiester bonds between both the strands b) Alignment of either of the...

Q:

A certain double stranded segment of human DNA contains 30%C+G bases. The double stranded DNA has a melting temperature of 82C in 150mMNaCl. (a) Sketch a plot showing the change in absorbance (Abs)...

Q:

What is the function of DNA helicase in DNA replication? A . Removal of negative supercoiling to allow for replication. B . Removal of positive supercoiling to allow for replication. C . Separation...

Q:

1. Which of the following cannot be used for the separation of nucleic acids? a) SDS - PAGE b) PAGE c) Northern blotting d) PAGE 2. The polymerization of the gel used in PAGE occurs between...

Q:

Which of the following does not affect the formation of hybrid DNA? a) Ionic strength b) Pressure c) Temperature d) Homologous DNA 2. Which of the following is not termed as hybridization? a) DNA and...

Q:

What is a restriction endonuclease? An enzyme which cuts single - stranded DNA at specific sequences. An enzyme which cuts double - stranded DNA at specific, often palindromic sequences An enzyme...

Q:

John Tan has just graduated from Sunway University with a BSc (Hons) in Cyber Security. As a top student he was head hunted by the government and started working as a cyber security analyst at Bukit...

Q:

Refer to the heart rate distribution of Exercise 4.S.16. If we use the 1.5 IQR rule, from Chapter 2, to identify outliers, how large would an observation need to be in order to be labeled an outlier...

Q:

How to prepare a before-the-fact flexible budget?

Q:

St. Thomas Yacht Services, Inc. had the following transactions during its first month of operations: Dec 2 Dec 4 Dec 7 Dec 8 Dec 9 Dec 12 Dec 15 Dec 17 Dec 18 Dec 22 Dec 23 Dec 25 Dec 26 Dec 29 Dec...