Question: The q , strand is the same sequence as the mRNA, whereas the strand is complementary to the mRNA. If the DNA sequence of the

The q, strand is the same sequence as the mRNA, whereas the strand is complementary to the mRNA. If the DNA sequence of the template strand is 5'- GGA-3', then the mRNA sequence is 5' encodes the amino acid
coding; template; UCC; serine
template; coding; UCC; serine
coding; template; TCC; glycine
coding; template; CCU; serine
The q , strand is the same sequence as the mRNA,

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

1. For each of the following nucleotides, identify the components and whether the nucleotide is found in DNA only, RNA only, or both DNA and RNA: a. deoxyguanosine-5'-monophosphate (dGMP) b....

Q:

Given the following nucleotide sequence in DNA: 5ACGCGATTC3: (a) Determine the sequence of the complementary strand of DNA. Report this sequence by writing it from its 5 end to its 3 end. (b) Write...

Q:

Given the following nucleotide sequence in DNA: 5TCGTAGGAT3: (a) Determine the sequence of the complementary strand of DNA. Report this sequence by writing it from its 5 end to its 3 end. (b) Write...

Q:

1. If a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? 2. The complementary strand from item 1 undergoes transcription. What will be...

Q:

Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...

Q:

Problem 1 (15 points) You are given the following DNA sequence, which is believed to contain a small protein-coding gene. GGAGGCGTAA AATGCGTACT GGTAATGCAA ACTAATGG If this sequence is fully...

Q:

The red cone pigment is one of the light receptors in the vertebrate eye (an "opsin" protein), sensitive to red, yellow and orange light wavelengths. The red cone opsin protein is encoded by a gene...

Q:

Examine the Figure below. The letters A to D represent a mutation in the DNA sequence. Specifically they represent a deletion of 2 nucleotides in the DNA sequence. Which of the mutations (A-D) will...

Q:

This is suppose to be one program in C++. "Use arrays to store data for analysis. Use functions to perform analysis. Part 0 Standard HeaderPut your standard output information in a function named...

Q:

You are the only European firm selling vacation trips to the North Pole. You know only three customers are in the market. You offer two services, round trip airfare and a stay at the Polar Bear...

Q:

Show that if T is square and if T4 is the zero matrix then (I - T)-1 = I + T + T2 + T3. Generalize.

Q:

External auditors need to understand internal controls in order to develop appropriate audit procedures to determine whether misstatements exist in the financial statements Question 1 3 options:...

Q:

Integrated Case: Allied Food Products 12-19 CAPITAL BUDGETING AND CASH FLOW ESTIMATION Allied Food Products is considering expanding into the fruit juice business with a new fresh lemon juice...