The tram starts moving at moment t = 0 with the constant acceleration of 0.4 m/s?. Find

Fantastic news! We've Found the answer you've been seeking!

Question:

The tram starts moving at moment t = 0 with the constant acceleration of 0.4 m/s?. Find the maximum time, when the passenger could wait and then catch up the tram by running after with the constant velocity of 5 m/s.

Related Book For answer-question

University Physics with Modern Physics

ISBN: 978-0321501219

12th Edition

Authors: Hugh D. Young, Roger A. Freedman, Lewis Ford

See More Books

Posted Date: Jan 29, 2024 08:59 AM

See More Questions

what ways does the study of phenotypes inform our understanding of complex biological phenomena, including disease susceptibility, ecosystem dynamics, and evolutionary processes, providing insights...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
To determine the resistances of two resistors that are to be in parallel in an electric circuit, it is necessary to solve the equation Find R (to nearest 1). 20 + R 20 R + 10 5
A company sells four types of gift packages. The cost per unit and demand for each package type is shown in the table below. A fixed cost of $1,000 is also incurred for each different type of gift...
What would be the biggest problem in implementing an ERP in your department?
What mass (in grams) of sodium hydroxide (NaOH, molar mass = 40.0 g.mol-1) is needed to make 57.6 mL of a 0.122 M NaOH solution?
Assume that Henson Corporations comparative balance sheet reported these amounts: Requirement 1. Assume that on January 2, 2010, Henson sold 1/10 of its plant and equipment for $75,500 in cash....
Suppose during 2014, Cypress Semiconductor Corporation reported net cash provided by operating activities of $89,303,000, cash used in investing of $43,126,000, and cash used in financing of...
1Aguila Sweets Factory manufactures coconut candy called Coco which is sold for P50 per box. The manufacturingl process also yields a by-product named Soloc. Without further processing, Soloc sells...
Create a set of use cases for the following high-level requirements in a housing system run by the Campus Housing Service. The Campus Housing Service helps students find apartments. Owners of...
Schofields Stores carried out the following transactions relating to a single product in October: Oct. 5 Purchased 100 units for $60 each on credit. 11 Sold 112 units for $90 each on account. 13 A...
Cash increases occur anytime you have a decrease in any asset or an increase in liabilities. How is this? B. Create an internal cash budget based on the following information: Sales = $50,000 Rent =...
a. You are given the following data for Bond Ace and Bond Diamond. Both bonds have a face value of RM100 each. ii. iii. iv. Item Price Coupon Yield to Maturity Years to Maturity Rating Required: i....
Businesses contribute intensely to achieving the fundamental goals to any national economy, becoming the back bone of social-economical progress - Peter Drucker, 2009. The SME sector plays an...
Consider a plant that satisfies the following requirements and find the transfer function of the plant. The plant have two poles and one zero. The gain of the plant is two. The maximum overshoot is...
An investor is holding 1,000 shares of Limited Company. Presently the rate of dividend being paid by company is 2 per share and the share is being sold at 25 per share in the market. However, several...
You have been hired to test whether the demand for a product that your client produces varies between two demographic markets the Urban and Rural markets. As such, in each market, you run a short...
Should U.S. antidumping laws be stated in terms of average total costs or average variable costs?
A ship leaves the island of Guam and sails 285 Ian at 40.0 north of west. In which direction must it now head and how far must it sail so that its resultant displacement will be 115 Ian directly east...
You are using water to dilute small amounts of chemicals in the laboratory, drop by drop. How many drops of water are in a 1.0 L bottle? (Hint: Start by estimating the diameter of a drop of water.)
A nonuniform, but spherically symmetric, distribution of charge has a charge density p (r) given as follows: Where P0 is a positive constant (a) Find the total charge contained in the charge...
What forms of business organization are permitted under Rule 505-Form of Practice and Firm Name?
There currently are thirteen Rules of Conduct. Listed below are circumstances pertaining to some of these rules: 1. A member shall exercise due professional care in the performance of an engagement....
a. What aspects of a company's financial statements are covered in the first three reporting standards? b. What is the objective of the fourth standard of reporting?

The tram starts moving at moment t = 0 with the constant acceleration of 0.4 m/s?. Find

Question:

Expert Answer:

To find the maximum time when the passenger could wait and then catch up to the tram we can set up t... View the full answer

University Physics with Modern Physics

Students also viewed these physics questions