Question: Use python to answer! oneFrane Write a function oneframe (DNA) that starts at the 0 position of DNA and searches forward in units of three

Use python to answer!

of three looking for start codons. When it finds a start codon,

oneFrane Write a function oneframe (DNA) that starts at the 0 position of DNA and searches forward in units of three looking for start codons. When it finds a start codon, onefrane should take the slice of DNA beginning with that "ATG" and ask restoFOrF for the open reading frame that begins there. It should store that sequence in a list and then continue searching for the next "ATG start codon and repeat this process. Ultimately, this function returns the list ot all ORFs that it found. Here are some examples of oneFrane in action onefrane ( ccCTTTTTGAAAATOCCCGGGTAA-) >>> oneFrane("CCATGTAGAAATGCCC") [1 >oneFrane("ATGCCCATGGGGAAATTTTGACCC") 'ATOCCCATOGGGAAATTTATG0GGAAATTT

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Use python to answer! oneFrame Write a function oneFrame (DNA) that starts at the 0 position of DNA codon, oneFrame should take the slice of DNA beginning with th that sequence in a list and then...

this is my oneframe function and i jsut need help with writing a funcition for the longestORF that uses one frame. Thank you! oneframe Write a function on that starts at the position of DNA and...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Finding genes in DNA is a fundamental problem in biology. After all, only a few percent of human DNA actually contains protein-coding genes. Sifting through the more than 3 billion base pairs to find...

Answer in python 2.7 please . I am really struggling with this and i really would love your help. Its due today and i am especially stuck on question 3 which builds on from the other codes like...

please help with this code, I am confused. thank you! UnknownSeqs Layout References Mailings Review View Help Search A A Aa P A.D.A. S S 21 st. - - AaBbCcDc AaBbCcDc AaBb C AaBbcc 1 Normal No Spac......

Prompt: Given the genomic sequences for an organism; one of the first steps in identifying the genes is to identify the open reading frames (ORFs). An open reading frame is a maximal length sequence...

The first two images are the templates, and 5 6 def read_one_seq_fasta (fasta_file): 7 8 9 10 11 12 13 14 15 16 def gc_content (seq): 17 pass """Read a FASTA file that contains one sequence. seq =...

""" Code file for M269 20J TMA01 Question 3. Student version 4: 24/03/20 """ """ The following table determines which amino acid is produced by a particular 3-base DNA codon. It uses a Python...

Python and most Python libraries are free to download or use, though many users use Python through a paid service. Paid services help IT organizations manage the risks associated with the use of...

Two elements, Pumpkinium (Pm) and Candium (Cn) combine to form several Compounds including Pm2Cn3 & Pm2Cn5. A 254 g sample of Pm2Cn3 has 6.77 10 24 atoms total. Find the relative mass of Pm to...

On January 1, 2022, Thiaville Trucks sold five trucks to Krueger Transport Co. In exchange for the trucks, Thiaville received a note requiring payment of $515,000 by Krueger on December 31, 2024. The...

Which of the following statements is CORRECT? A zero coupon bood of any maturity will have move prose risk than any coupos bond, even a perpetaity. have more price risk than a 1 0 4 6 compen bood. A...

Cyber Syma company that makes connections for common The company has becoso for each come and be 6.000 les of connection in August, but the company actually produced and sold only connectors at a...

1. How did Christine Taylor succeed in evolving the local dog washing service she developed as a teenager into an international franchise business?

4. What action should Cherita Howard take and why?

2. Compare and contrast the tasks involved in recruiting new customers and recruiting new franchisees.