Question: Use python to answer! oneFrame Write a function oneFrame (DNA) that starts at the 0 position of DNA codon, oneFrame should take the slice of

Use python to answer!

oneFrame Write a function oneFrame (DNA) that starts at the 0 position of DNA codon, oneFrame should take the slice of DNA beginning with th that sequence in a list and then continue searching for the nextATG star all ORFs that it found. and searches forward in units of three looking for start codons. When it finds a start at .ATG" and ask restofoRF for the open reading frame that begins there. It should store t codon and repeat this process. Ultimately, this function returns the list of Here are some examples of oneFrame in action: >> oneFrame("CCCATGTTTTGAAAAATOCCCOGGTAAA ['ATGTTTATGCCCGGG oneF rameC "CCATOTAGAAATOCCC") I1 >>> oneFrame"ATGCCCATGGGGAAATTTTGACCC) C'ATOCCCATGGGGAAATTT' ATGGGGAAATTT

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Use python to answer! oneFrane Write a function oneframe (DNA) that starts at the 0 position of DNA and searches forward in units of three looking for start codons. When it finds a start codon,...

this is my oneframe function and i jsut need help with writing a funcition for the longestORF that uses one frame. Thank you! oneframe Write a function on that starts at the position of DNA and...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Finding genes in DNA is a fundamental problem in biology. After all, only a few percent of human DNA actually contains protein-coding genes. Sifting through the more than 3 billion base pairs to find...

Answer in python 2.7 please . I am really struggling with this and i really would love your help. Its due today and i am especially stuck on question 3 which builds on from the other codes like...

please help with this code, I am confused. thank you! UnknownSeqs Layout References Mailings Review View Help Search A A Aa P A.D.A. S S 21 st. - - AaBbCcDc AaBbCcDc AaBb C AaBbcc 1 Normal No Spac......

The first two images are the templates, and 5 6 def read_one_seq_fasta (fasta_file): 7 8 9 10 11 12 13 14 15 16 def gc_content (seq): 17 pass """Read a FASTA file that contains one sequence. seq =...

Prompt: Given the genomic sequences for an organism; one of the first steps in identifying the genes is to identify the open reading frames (ORFs). An open reading frame is a maximal length sequence...

BME 201 HOMEWORK 5 - How to fix the code for DNA Replication, Transcription, and translation. InsulinDNAseq is included. Please help! 0 10f7 BME 201 Homework 5 - Molecular Biology: Transcription and...

3 reading frames EDITED - The script that I attached below needs to be modified so that it returns a list of 3 amino acid strings. A function (forloop) that can slice the DNA into three different...

Starlight Glassware Company has the following flexible budget data and standards. Standard Variable Overhead Rate ps 6.00 per direct labor hour Standard amount of direct labor 3 hours per unit of...

Why countries such Australia-Japan rely on export and import on agricultural sectors?

Because public utilities and railroads often involve essential services, reorganizations and mergers rather than liquidations are likely to take place. This is less true for industrial companies....

Seved Help 14 Wisconsin Snowmobile Corp. is considering a switch to level production Cost efficiencies would occur under level production, and aftertax costs would decline by $31,500, but inventory...

1. How will you, as city manager, handle these requests?

1. Identify the sources for this conflict.

3. How would you address the problems that make up the situation?