Using PERL syntax/programming.

-Write a script to generate random DNA sequences of a given length.

$ ./random.pl AAACGCAAGGGTATGTATAACAAGGCTTGCTCGATGTTGGAAGGGTGGAC 

-Rewrite the script from the last question as a function, taking an argument for the length of the sequence that is returned. Write the function such that a second, optional argument, if provided, will cause the function to produce a sequence of a random length between 1 and the first argument.

-Use the program from the previous problem to generate 10 random DNA sequences of at least 50 bases. Save them in 10 distinct files (don't forget to remove any header you added). Write a program that prints the names of the files that contain sequences that have at least one run of four identical bases in them.

$ ./base_find.pl T run found in ./seq2 G run found in ./seq4 T run found in ./seq6 G run found in ./seq7 T run found in ./seq8 

Write a regexp debugger: Code which asks for a regular expression, then tests inputs against that regular expression and reports whether or not they match. It should also support an 'exit' command to allow quitting. Sample output:

$ ./regexp_debug.pl Enter regexp: oo Enter string or 'exit' to exit; foo Match! Enter string or 'exit' to exit; bar No match! Enter string or 'exit' to exit; exit bye bye!