Question: What is a referential integrity constraint? Define the term and give an example of its use. Explain the role of referential integrity constraints in normalization.

What is a referential integrity constraint? Define the term and give an example of its use.





Explain the role of referential integrity constraints in normalization.

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Q:

Describe how to construct the function cpo ((D E), v) of two cpos (D, vD) and (E, vE). Prove that ((D E), v) is a cpo. (You may use facts about least upper bounds provided you state them clearly.)...

Q:

QUIZ... Let D be a poset and let f : D D be a monotone function. (i) Give the definition of the least pre-fixed point, fix (f), of f. Show that fix (f) is a fixed point of f. [5 marks] (ii) Show that...

Q:

Let r and s be solutions to the quadratic equation x 2 b x + c = 0. For n N, define d0 = 0 d1 = r s dn = b dn1 c dn2 (n 2) Prove that dn = r n s n for all n N. [4 marks] (b) Recall that a commutative...

Q:

What is a referential integrity constraint? Define the term, and give an example of its use. Are null values allowed in foreign key columns with a referential integrity constrain? How does the...

Q:

4 Comparative Programming Languages illustrating your answer by explaining the meaning of the following fragment of code: [self isAwake] whileTrue: [| item | item := self askForCookie. (self...

Q:

CS 411-01 Assignment 3 Cascade?) of enforcing each of the violated constraint. A For example, say, if you have one violated (referential integrity) constraint, you write down at maximum', the 5...

Q:

Describe, in outline, each of the implicit surface, NURBS surface, and constructive solid geometry methods for defining three-dimensional shapes. (b) Compare and contrast the three methods. (a)...

Q:

QUESTION 1 (a) Describe the main characteristics of the database approach and contrast it with the file-based approach. (b) The following records are saved in spreadsheet (see Figure 1). [4 marks]...

Q:

Cascade) of enforcing each of the violated constraint. For example, say, if you have one violated (referential integrity) constraint, you write down maximum, the 5 different actions applying to this...

Q:

Q:Question:Explain the term foreign key and and give an example of its use, then define the term referential integrity constraint and give an example of its use aswell. How does referential integrity...

Q:

A condition of AICPA membership is A. Membership in the SEC Practice Section. B. Membership in the Private Companies Practice Section. C. Participation in an approved practice-monitoring program. D....

Q:

Bill Gate Company incurred costs for materials and conversion in the amount of P 45,000 and P 4,860 respectively. As of the same date, the work in process inventory in units of P 6,000 is 40%...

Q:

Budget cash receipts for the months of January, February, and March. Budgeted sales, all on account: November $ 65,000 December January February March 60,000 82,000 70,000 90,000 Collection of...

Q:

Zerample State the three Laws of Thermodynamics and explatn their meanings. Answe (d) State the ideal gas law. Explutn the meaning of each symbol- When can a fluid be constdered tncompressible? Gve...

Q:

Electrical Engineering 1. Consider the anmplitier basesd on the CCCS and shown below. (1) With a signal source having a Thvenin equivalent with an open-circuit voltage n, and oquivalent resistance R,...

Q:

Question: In 2017, Riverside began work on an outdoor amphitheater and concession stand at the city's park. It is to be financed by a $5,400,000 bond issue and supplemented by a $690,000 General Fund...

Q:

1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats contains three (3) molecules of glucose. 2. Assuming Princes uses 180 molecules of adenosine triphosphate in...

Q:

You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below: 3CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5 Additional tools are provided below. a)...

Q:

Corning - Howell reported taxable income in 2 0 2 4 of \ ( \ $ 1 3 6 \ ) million. At December 3 1 , 2 0 2 4 , the reported amount of some assets and liabilities in the financial statements differed...

Q:

If you were about to create an index on a relation, what considerations would guide your choice? Discuss: 1. The choice of primary index. 2. Clustered versus unclustered indexes. 3. Hash versus tree...

Q:

Briefly answer the following questions: 1. Define the term functional dependency. 2. Why are some functional dependencies called trivial? 3. Give a set of FDs for the relation schema R(A,B,C,D) with...

Q:

Briefly answer the following questions based on this schema: 1. Suppose you have a view SeniorEmp defined as follows: CREATE VIEW SeniorEmp (sname, sage, salary) AS SELECT E.ename, E.age, E.salary...

Q:

Refer to the information for Ironman Steel below. On January 1, 2020, Ironman Steel issued $1,300,000, 8-year bonds for $1,340,000. The stated rate of interest was 7% and interest is paid annually on...

Q:

Refer to the information for Cookie Dough Corporation below. Cookie Dough Corporation issued $850,000 in 9%, 10-year bonds (payable on December 31, 2030) on January 1, 2021, for $907,759. Interest is...

Q:

On January 1, 2019, Brock & Co. issued $600,000 of bonds payable at par. The bonds have a 9% stated rate, pay interest on March 31, June 30, September 30, and December 31, and mature on December 31,...