Question: Write a program, named writing_a_fasta_file.py, that will create a FASTA file for the following three sequences make sure that all sequences are programmatically converted to

Write a program, named writing_a_fasta_file.py, that will create a FASTA file for the following three sequences make sure that all sequences are programmatically converted to upper case and only contain the bases A, T, G and C.

Sequence header Alien_DNA_1

Alien_DNA_1

Alien_DNA_3

DNA sequence

CAAGAACAGTGGATGAAGAAA

tactcagcgaagatgagagg

TATA---AAC-TCCACA--CCAGCAC

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Needed help on this one, thankss!! In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take two command line...

In this assignment youll write a program that encrypts the alphabetic letters in a file using the Vignere cipher. Your program will take two command line parameters containing the names of the file...

in java please In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take two command line parameters containing the...

Program #1 Vigenre Cipher (100 points) In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take two command line...

In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take two command line parameters containing the names of the file...

In this assignment, you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take two command line parameters containing the names of the file...

Vigenere Encryption Language of code can be either C, CPP, or Java , please show the gcc command example of the program running if possible. Included Files: Please create files that match the k1.txt...

In this assignment you'll write a program that encrypts the alphabetic letters in a file using theVigenre cipher. Your program will take two command line parameters containing the names of the file...

In C Programming Please Please make it as simple as you can In this assignment you'll write a program that encrypts the alphabetic letters in a file using the Vigenre cipher. Your program will take...

Program 1 (20 pts) Write a program that opens a PrintWriter writing to a file named numbers.txt. Write to this file the even numbers between 0 and 100000, 1 number per line. Open the created file and...

Wendy Jones of Whitehorse has hired you as her bookkeeper to record the following transactions in the cash payments journal. She would like you to record and post as appropriate and supply her with a...

Prove that if (an diverges and (bn converges, then ((an + bn) diverges?

What are three key financial ratios used to assess a company's solvency?

The mechanic told Beth her car would be ready Tuesday afternoon. Unfortunately, it was not ready until Thursday. Beth was very unhappy. This is an example of the impact of on the consumer decision...

1. Are my sources credible?

3. Are my sources accurate?

1. Is it a topic you are interested in and know something about?