Write a Python script that converts sequence information from EMBL format to FASTA format The script. must process one EMBL record. That is, write a Python script that extracts nucleotide sequence information from one complete record in EMBL format, and outputs it as a valid record in FASTA format. - The script reads its input from the file whose name is specified on the command tine. - Your script should report error messages if the file name is not provided as a command line argument or the provided file name can not be open. - The output is to be produced on the standard output - Make sure that the script produces a FASTA record with a properly formed FASTA header. - Use BioPython libraries in your script. Hints: - If your input file was the nucleotide sequence from ENA with ID EAL23820 (the sequence for human EphB4), converting it to FASTA with your script should produce output that begins >EAL23820.1 Homo sapiens (human) EphB4 ATGGAGCTCCGGGTGCTGCTCTGCTGGGCTTCGTTGGCCGCAGCTTtGGAAGAGACCCTG CTGAACACAAAATTGGAAACTGCTGATCTGAAGTGGGTGACATTCCCTCAGGTGGACGGG CagtgGgaggaactGagCGGCctGgatgaggaacagcacagCGtGCGCacctacgaagtG TGTGACGTGCAGCGTGCCCCGGGCCAGGCCCACTGGCTTCGCACAGGTTGGGTCCCACGG CGGGGCGCCGTCCACGTGTACGCCACGCTGCGCTTCACCATGCTCGAGTGCCTGTCCCTG CCTCGGGCTGGGCGCTCCTGCAAGGAGACCTTCACCGTCTTCTACTATGAGAGCGATGCG GACACGGCCACGGCCCTCACGCCAGCCTGGATGGaGAACCCCTACATCAAGGTGGACACG