write a python script that prompts for a DNA sequence (assume all caps, no spaces, and only 'A, T, C, G'). For each palindrome that is not part of a larger palindrome, your script should print the start index, end index, and sequence on one line. Assume that there are no palindromes that overlap. Only report palindromic sequences that are 4 nucleotides or longer. Example. For input DNA TGGAATTCGTGAGCGGATAAGCTTAC, the output should be (vertical order of lines is not important for grading): 2 7 GAATTC 17 24 TAAGCTTA Stage 3 (max score: 10) write a python script that prompts for a DNA sequence (assume all caps, no spaces, and only A', T, C, G'). For each palindrome that is not inside of a larger palindrome, your script should print the start index, end index, and sequence on one line. Your script should find palindromes that overlap. Only report palindromic sequences that are 4 nucleotides or longer. Example. For input DNA TGGAATTCGAATGAGCGGATAAGCTTAA, the output should be (vertical order of lines is not important for grading). 2 7 GAATTC 4 11 ATTCGAAT 19 26 TAAGCTTA 24 27 TTAA