Write a python script that prompts for a DNA sequence (assume all caps, no spaces, and only 'A, 'T, 'C, 'G'). Your script should find all palindromic sequences within the DNA sequence. For each palindromic sequence found, print the start index, end index, and sequence on one line. Only report palindromic sequences that are 4 nucleotides or longer. Example. For input DNA TGGAATTCGTGAGCGGATAAGCTTAC, the output should be (vertical order of lines is not important for grading, vertical order may be a hint for next stage though...) 2 7 GAATTC 3 6 AATT 17 24 TAAGCTTA 18 23 AAGCTT 19 22 AGCT