Question: Write the amino acid sequence that will derive from the following DNA sequ Only use single letter amino acid codes, do not put a space

Write the amino acid sequence that will derive from the following DNA sequ Only use single letter amino acid codes, do not put a space between the letter

5'

CCATGACCTAACCCCCACCATGGAACCCTAACTAATGA

- 3'

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

A peptide was treated separately with trypsin and chymotrypsin then sequenced by Edman degradation. The following fragments were obtained: Trypsin Digest - MQYVWR - WAIK - CTR - HLFK - TLR...

Working with FASTA data Modules you can use: sys (Links to an external site.) collections (Links to an external site.) os (Links to an external site.) re (Links to an external site.) argparse (Links...

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Please answer the following problems in their entirety using Python. Code all questions in a single Jupyter notebook 1. Compute the number of point mutations (i.e., the number of differences) between...

working with fast files, create 4 python scripts named nt_fasta_stats.py, secondary_structure_splitter.py, test_nt_fasta_stats.py , test_secondary_structure_splitter.py, .coveragerc, README.md...

Question 2 : ( 1 5 Marks ) Please refer to the following peptide structure for the subsequent questions: a . What is the amino acid sequence of this peptide using 1 letter code ( 5 marks ) ? b . Use...

in python..please follow rewuirements. program requirement. simple and clear write a function named clean_sequence() takes a string as its single parameter. It will use a for loop to go through the...

wrting programing python PLE HELP ME BY PYTHON, THIS IS ONE PROBLEM BUT IT 'S SO LONG. THANKS U SO MUCH DNA is made up of sequences of nucleotides. There are four nucleotides: Adenine, Cytosine,...

IN python: please follow all the requirements. make it it simple and clear. = EVC-2020SPI-COMSC-020-202 > Assignments > Dictionaries Spring 2020 Intersession Dictionaries Login Home Assignments Due...

Write a reference class called DNASequence. This will contain the name of a species (as a string) and a sequence of DNA nucleotides, also called bases. There are four kinds of bases: adenine (A),...

The total energy of a blackbody radiation source is collected for one minute and used to heat water. The temperature of the water increases from 20.0C to 20.5C. If the absolute temperature of the...

Monthly rent at an apartment complex is $500. Operating costs average $15,000 per month regardless of the number of units rented. Construct a spreadsheet model to determine the profit if 35 units are...

if there is tra group sales , how to account it for consolidation entries

2. (LO 3) Determine the missing amounts. Unit Selling Unit Variable Price Costs Unit Contribution Margin Contribution Margin Ratio $800 $520 (a) (b) 500 (c) $200 (d) (e) (f) 450 45%